We narrowed to 3,652 results for: pcas9
-
Plasmid#223403PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for dicot plants; NGG PAM; SpCas9D10A-ABE was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-ecTadA8e-SpCas9-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT33
Plasmid#223405PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for dicot plants; NGG PAM; SpCas9D10A-ABE was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-SpCas9-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT34
Plasmid#223406PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT35
Plasmid#223407PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT36
Plasmid#223408PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
UseTagsExpressionMammalianMutationPromoterU6 / PCAGAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.3TOPO-T7-hCas9
Plasmid#161876PurposeIn vitro transcription of SpCas9DepositorInserthuman codon optimized SpCas9
UseTagsExpressionBacterial and MammalianMutationPromoterCMVAvailable sinceSept. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
LP102: pMAGIC (R4-R3) NLS-Sp Cas9-NLS
Plasmid#132927PurposepMAGIC R4-R3 entry plasmid, contains 2xNLS SpCas9 (nuclease active) for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInserthumanized SpCas9
UseCRISPR and Synthetic Biology; Pmagic gateway entr…TagsExpressionMutationPromoterAvailable sinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX551
Plasmid#60957PurposepAAV-pMecp2-SpCas9-spA (AAV-SpCas9). AAV plasmid expressing Cas9 in neurons under control of truncated mecp2 promoter.DepositorInsertSpCas9
UseAAV and CRISPRTagsHAExpressionMammalianMutationPromoterpMecp2Available sinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
BPK764
Plasmid#65767PurposeBacterial expression plasmid for SpCas9 & sgRNA (need to clone spacer into BsaI sites): T7-humanSpCas9-NLS-3xFLAG-T7-BsaIcassette-Sp-sgRNADepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9-NLS-3XFlag, and SpCas9 gRNA
UseCRISPRTags3x FLAG and NLSExpressionBacterialMutationPromoterT7 (x2)Available sinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pmCherry_sgRNA-ver2
Plasmid#126776PurposegRNA expression vector with mCherry transfection control, does not contain the direct repeat of the truncated guideRNADepositorInsertsgRNA (for SpCas9)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330 EGFR-sgRNA
Plasmid#188633PurposeA human codon-optimized SpCas9 and chimeric guide RNA targeting C-terminus of human EGFRDepositorInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianMutationPromoterCBhAvailable sinceAug. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ262F-ABE8e
Plasmid#199179PurposeGateway entry clone (attL1 & attR5) for CRISPR-zSpCas9 ABE8e-HF mediated A-G base editingDepositorInsertABE8e(V106W)-zSpCas9(D10A)
UseCRISPR; Gateway compatible abe8e(v106w)-zspcas9(d…TagsNLSExpressionPlantMutationPromoterAvailable sinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pScCas9
Plasmid#117700PurposeMammalian expression vector encoding WT ScCas9DepositorInsertStreptococcus canis Cas9
UseCRISPRTagsExpressionMammalianMutationPromoterEF-1αAvailable sinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFH13
Plasmid#125798PurposeLevel0 SpCas9, wheat codon optimizedDepositorInsertSpCas9, wheat codon optimized
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH32
Plasmid#125809PurposeLevel0 SpCas9-NG, human codon optimizedDepositorInsertSpCas9-NG, human codon optimized
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDG458
Plasmid#100900PurposeSpCas9 with 2A-EGFP and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.DepositorInsertshumanized CRISPR associated protein 9
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAGExpressionMammalianMutationPromoterCBh and U6Available sinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#206994PurposePlasmid expressing both SpCas9 and SaCas9DepositorUseTagsP2AExpressionMammalianMutationPromoterCMVAvailable sinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQ265E9
Plasmid#213472PurposeGateway entry clone (attL1 & attR5) TadDE-32aa linker-zSpCas9-D10A-2xUGI for C-T and A to G base editingDepositorInsertTadDE-32aa linker-zSpCas9-D10A-2xUGI
UseCRISPR; Gateway compatible tadde-32aa linker-zspc…TagsNOExpressionPlantMutationPromoterAvailable sinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSP2372
Plasmid#73196PurposeHuman expression plasmid for SpCas9(R661A/Q695A/Q926A) variant: CMV-T7-humanSpCas9(R661A, Q695A, Q926A)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (R661A/Q695A/Q926A)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationR661A, Q695A, and Q926A in SpCas9PromoterCMVAvailable sinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only