We narrowed to 5,631 results for: crispr cas9 grna plasmid
-
Plasmid#226992PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 2b must be used with gRNA 1a or 1bDepositorInsertSpCas9 gRNA 2b to create OPA1-del_exon5
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA1b_(CJT92)
Plasmid#226990PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 1b must be used with gRNA 2a or 2bDepositorInsertSpCas9 gRNA 1b to create OPA1-del_exon5
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A9-gRNA_(CJT87)
Plasmid#226988PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A9)DepositorInsertSpCas9 gRNA A9 to create OPA1-R194G
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
1782_pAAV-U6-Ai9-Sa-gRNA2-CB-SACas9-HA-OLLAS-spA_C
Plasmid#135978PurposegRNA against the right loxP site of the Ai9 alleleDepositorInsertAi9 gRNA2
UseAAV, CRISPR, and Mouse TargetingTagsHAExpressionMutationPromoterCBAvailable sinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
1781_pAAV-U6-Ai9-Sa-gRNA1-CB-SACas9-HA-OLLAS-spA_C
Plasmid#135979PurposegRNA against the left loxP site of the Ai9 alleleDepositorInsertAi9 gRNA1
UseAAV, CRISPR, and Mouse TargetingTagsHAExpressionMutationPromoterU6Available sinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEJS1089: mini-AAV.sgRNA.Nme2Cas9
Plasmid#159536PurposeDelivery of Nme2Cas9 and its sgRNA in a single AAV vector with overall packaging size of 4.4 KbDepositorInsertNme2Cas9 with single guide RNA cassette
UseAAV, CRISPR, and Mouse TargetingTagsNLSExpressionMammalianMutationPromoterU1aAvailable sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA TdR
Plasmid#80940PurposeExpresses Cas9N in mammalian cells; expresses gRNA TdR for Ai9 cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA TdL
Plasmid#80938PurposeExpresses Cas9N in mammalian cells; expresses gRNA TdL for Ai9 cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)sgRNA_CAG-Cas9-bpA_EF1-TagRFP
Plasmid#86987PurposeFor cloning and expression of sgRNA together with expression of Cas9 and TagRFPDepositorInsertCas9
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
U6_ ATM_G101_sgRNA_CAG_St1Cas9_CNRZ1066_v2
Plasmid#214814PurposeA single vector containing a CAG-driven Cas9 variant from S. thermophilus recognizing a consensus NNACAA PAM (St1Cas9 CNRZ1066 v2) and its U6-driven sgRNA targeting human ATMDepositorInsertSt1Cas9 CNRZ1066 v2 targeting ATM (ATM Human)
UseCRISPRTagsExpressionMammalianMutationPromoterCAGAvailable sinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
1518_pAAV-U6-SA-eGFP-gRNA-HLP-SACas9-HA-OLLAS-spA
Plasmid#109316PurposePlasmid for liver-specific expression of AAV SaCas9 with a gRNA against eGFPDepositorInserteGFP gRNA
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
1476_pAAV-U6-SA-mMttp-gRNA-N21-HLP-SACas9-spA
Plasmid#109315PurposePlasmid for liver-specific expression of AAV SaCas9 with a gRNA against MttpDepositorInsertMttp gRNA
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-ABE-3'UTR-sgRNA-2xMS2
Plasmid#132554PurposeVector plasmid expressing ABEmax and sgRNA scaffold with MS2 replacing the Tetraloop and loop 2DepositorInsertsABEmax
sgRNA, with Tetraloop and loop 2 replaced by MS2 aptamer
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)sgRNA_CAG-Cas9-venus-bpA
Plasmid#86986PurposeFor cloning and expression of sgRNA together with expression of a Cas9-Venus fusion proteinDepositorInsertCas9-venus
UseTagsCas9-Venus fusion proteinExpressionMammalianMutationPromoterCAGAvailable sinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: ATCAGTGATAGAGAACGTATGPromoterAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_LMD9_2xUGI_3xHA
Plasmid#136652PurposeExpresses St1BE4max-LMD9 in mammalian cells along with its U6-driven sgRNADepositorInsertsUseCRISPR and Synthetic BiologyTags2xUGI, APOBEC-1, SV40 NLS, UGI, and hSt1Cas9ExpressionMammalianMutationPromoterCAG and U6Available sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_TH1477_2xUGI_3xHA
Plasmid#136659PurposeExpresses St1BE4max-TH1477 in mammalian cells along with its U6-driven sgRNADepositorInsertsUseCRISPR and Synthetic BiologyTags2xUGI, APOBEC-1, SV40 NLS, UGI, and hSt1Cas9ExpressionMammalianMutationPromoterCAG and U6Available sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_LMG18311_2xUGI_3xHA
Plasmid#136657PurposeExpresses St1BE4max-LMG18311 in mammalian cells along with its U6-driven sgRNADepositorInsertsUseCRISPR and Synthetic BiologyTags2xUGI, APOBEC-1, SV40 NLS, UGI, and hSt1Cas9ExpressionMammalianMutationPromoterCAG and U6Available sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_CNRZ1066_2xUGI_3xHA
Plasmid#136654PurposeExpresses St1BE4max-CNRZ1066 in mammalian cells along with its U6-driven sgRNADepositorInsertsUseCRISPR and Synthetic BiologyTags2xUGI, APOBEC-1, SV40 NLS, UGI, and hSt1Cas9ExpressionMammalianMutationPromoterCAG and U6Available sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eCas9-T2A-EGFP-U6-gRNA-no ITR and f1 ori
Plasmid#234724PurposeAll-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9 expression in neurons. The plasmid lacks AAV2 ITR and f1 ori elements, enabling more efficient transfection and expression.DepositorTypeEmpty backboneUseCRISPRTagsT2A-GFPExpressionMammalianMutationPromoterCAG promoterAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only