We narrowed to 81,798 results for: Mycs
-
Plasmid#176573PurposePlasmid for overexpression of recombinant AviTagged, His-tagged fusion protein mEGFP-DspB(E184Q), used as a fluorescent probe for detection of biofilm polysaccharide PNAG.DepositorInsertDispersin B
TagsAvitag, Hexahistidine tag, and mEGFPExpressionBacterialMutationE184QPromoterT7Available SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-Cas9-P2A-Puro_BsmBI-sgRNA-BsmBI
Plasmid#188703PurposeLentivirus transfer plasmid encoding Cas9, puromycin resistance, and a BsmBI array for cloning 4 sgRNAsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUltra-5HTP
Plasmid#178042PurposeExpress modified ScTrpRS/tRNA for genetic incorporation of 5HTP to TAG codonDepositorInsertsModified ScTrpRS for 5HTP incoporation
suppressor tRNA for 5HTP incorporation
ExpressionBacterialMutationT107C, P254T, C255AAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMS114
Plasmid#215677PurposeEmpty repair plasmid for ChrI split hygromycinR landing padDepositorInsert5'HA + MCS + loxN + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGSKU
Plasmid#72243PurposeContains the CORE cassette with convergent KlURA3 and KanMX4 markers and the I-SceI gene under the inducible GAL1 promoterDepositorInsertsKlURA3
kanMX4
I-SceI
ExpressionBacterialAvailable SinceJan. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
FRP1642_PTEF-HygMX-TTEF-insul-(lexA-box)4-PminCYC1
Plasmid#58442PurposeCassette to replace yeast promoters with an inducible promoter containing 4 lexA boxesDepositorInsertPTEF-HygMX-TTEF-insul-(lexA-box)4-PminCYC1
ExpressionYeastPromoterPTEF-HygMX-TTEF-insul-(lexA-box)4-PminCYC1Available SinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT31
Plasmid#223403PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for dicot plants; NGG PAM; SpCas9D10A-ABE was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-ecTadA8e-SpCas9-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMS158
Plasmid#215679PurposeEmpty repair plasmid for ChrIII split hygromycinR landing padDepositorInsert5'HA + MCS + lox2272 + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDN-Sth1Cas9
Plasmid#221386PurposeCas9 under control of AHT inducible TetR on integrating plasmid (KanR) using L5 integrase and attP for site-specific integration into attBDepositorInsertSth1 Cas9
UseCRISPRAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only