We narrowed to 27,306 results for: RON
-
Plasmid#159882PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG3 - 900 bp
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2214 - Intron GG1 - 900 bp
Plasmid#159880PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG1 - 900 bp
ExpressionWormMutationNot applicableAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-plasma in pMAX
Plasmid#120401Purposeenables eukaryotic expression of human plasma fibronectinDepositorAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
PP_072_pAAV_hSyn_DIO-LR-Voltron2-P2A-LR-CheRiff-HA
Plasmid#230988PurposeCo-expressing membrane-localized Voltron2 and membrane-localized CheRiff.DepositorInsertCre-dependent, membrane-localized optopatch for neuronal dendrites
UseAAVExpressionMammalianPromoterhSynAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOpen-lambda red operon
Plasmid#165521PurposeOperon containing Exo, Bet, and Gam. To use the lambda red recombineering system to modify your target DNA.DepositorInsertlambda red operon
UseSynthetic BiologyAvailable SinceAug. 3, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pWALIUM-intron 3x UAS attB
Plasmid#206360Purposeincludes two standard UAS cassettes and one UAS cassette designed to co-express shRNAs/shRNA clusters and prodein coding sequencesDepositorTypeEmpty backboneExpressionInsectAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
PCMV-intron myc Rab2WT
Plasmid#46779Purposeexpression of WT Rab2a in mammalian cellsDepositorAvailable SinceNov. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRS416-PTEF1-MCP-no_intron
Plasmid#127597Purposelow-copy URA-selectable plasmid, 1xFLAG-MCP under TEF1 promoterDepositorInsert1xFLAG-MCP expression cassette
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-EDA in pMAX
Plasmid#120402Purposeenables eukaryotic expression of human EDA (or EIIIA) containing fibronectin based on plasma fibronectin sequenceDepositorAvailable SinceJuly 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-EGFP-Donor
Plasmid#159740PurposeContains EGFP flanked by a splice acceptor and a splice donor. Together with other intron tagging plasmids, it can be used to place the EGFP tag as a synthetic exon into introns of target genes.DepositorInsertEGFP
UseIntron tagging donorAvailable SinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLZ29 (pCFJ151_Peft-3_degron_EmGFP_unc-54 3'UTR)
Plasmid#71719PurposeExpressing a GFP-tagged degron in the soma of C. elegansDepositorInsertauxin-responsive protein IAA17 (AXR3 Mustard Weed)
TagsEmGFPExpressionWormMutationminimal degron sequence (71-114aa) with start cod…Promotereef-1A.1 (eft-3)Available SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Chronos-tdTomato
Plasmid#62726PurposeAAV-mediated expression of Chronos-tdTomato under the Syn promoter. Using bGHpA signal. tdTomato has codons varied between the first and second tandem repeats to reduce recombination.DepositorHas ServiceAAV8InsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV Puro DEST P38KTRDronpa
Plasmid#205763PurposeExpression of P38 KTR Dronpa under CMV promoter (With Puromycin Resistance)DepositorInsertP38 KTR Dronpa
UseLentiviralExpressionMammalianMutationwtAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Chronos-GFP
Plasmid#59170PurposeAAV-mediated expression of Chronos-GFP under the Syn promoterDepositorHas ServiceAAV Retrograde, AAV1, and AAV5InsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterSynAvailable SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNAintron-CHIKV-Structural polyprotein
Plasmid#215698PurposeProduces the Chikungunya virus structural polyprotein Capsid-E3-E2-6K-E1DepositorInsertCHIKV structural polyprotein Capsid-E3-E2-6K-E1
ExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-hsyn-flex-Voltron
Plasmid#119035PurposeCre-dependant expression of Voltron in neuronsDepositorInsertVoltron
UseAAVExpressionMammalianPromoterhsynAvailable SinceDec. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2369 - intron GG1 - 250bp
Plasmid#159877PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertintron GG1 - 250bp
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-flex-Positron-ST
Plasmid#129267PurposeCre-dependant expression of soma-localized Positron in neuronsDepositorInsertPositron-ST
UseAAVExpressionMammalianMutationD92N, E199VPromoterhsynAvailable SinceOct. 18, 2019AvailabilityAcademic Institutions and Nonprofits only