We narrowed to 19,228 results for: Tat
-
Plasmid#217438PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with E45A mutation in CA).DepositorInsertgag/pol
UseLentiviralMutationCA E45AAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
Musunuru-Cowan TALEN Kit
Plasmid Kit#1000000034PurposeThis collection allows the efficient assembly of TALEN constructs with custom repeat arrays, each containing 15 repeats for expression in mammalian cells.DepositorApplicationGenome EditingVector TypeMammalian ExpressionEditing TypeTALENAvailable SinceJuly 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPTD-DRBD
Plasmid#35622DepositorInsertPKR DRBD-1
Tags6xHIS, HA, and TATExpressionBacterialPromoterT7Available SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] (AAV1)
Viral Prep#62723-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] (#62723). In addition to the viral particles, you will also receive purified pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] plasmid DNA. Cre-dependent expression of ChrimsonR-tdTomato under the control of the Synapsin promoter. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagstdTomato (Cre-dependent)Available SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Chronos-tdTomato (AAV8)
Viral Prep#62726-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Syn-Chronos-tdTomato (#62726). In addition to the viral particles, you will also receive purified pAAV-Syn-Chronos-tdTomato plasmid DNA. Syn-driven Chronos-tdTomato expression for optogenetic neuronal activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagstdTomatoAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
Plasmids for Multiplexed Optical Sensors Arrayed in Islands of Cells (MOSAIC)
Plasmid Kit#1000000175PurposePlasmids and Gateway entry vectors for fluorescent sensors of diverse physiological parameters in cells.DepositorApplicationGene Expression and LabelingVector TypeLentiviral, Mammalian ExpressionAvailable SinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO C1V1 (t/t)-TS-EYFP (AAV9)
Viral Prep#35497-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-Ef1a-DIO C1V1 (t/t)-TS-EYFP (#35497). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO C1V1 (t/t)-TS-EYFP plasmid DNA. EFIa-driven, Cre-dependent, C1V1 (t/t) fused to EYFP for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
Target Accelerator Pan-Cancer Mutant Collection
Plasmid Kit#1000000103PurposeGateway entry vectors containing wildtype and mutant alleles found across cancer types for "pan-cancer" analyses.DepositorApplicationGene Expression and LabelingVector TypeMammalian ExpressionAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET30a-His6-LOXCAT
Plasmid#140084PurposeFusion of A. viridans lactate oxidase (LOX) and E. coli catalase (CAT) that converts lactate into pyruvate without producing H2O2.DepositorInsertA fusion of lactate oxidase from A. viridans and catalase from E. coli
TagsHis6ExpressionBacterialPromoterT7Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ERBB3
Plasmid#116735PurposeLentiviral expression of ERBB3DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-RAD50
Plasmid#116784PurposeLentiviral expression of RAD50DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx2
Plasmid#82510PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cellsDepositorInsertChromobox Homolog 2 (CBX2 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromoteraggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaacc…Available SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
XE118 CAMKII-T286D-CS2+
Plasmid#16736DepositorAvailable SinceMarch 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
CMV Marina-T2A-nls-mCherry
Plasmid#74216Purposegenetically-encoded fluorescent voltage indicatorDepositorInsertfluorescent protein voltage sensor
TagsmCherryExpressionMammalianMutationCi-VSP contains R217Q mutation; super ecliptic pH…PromoterCMVAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EGFR-L858R
Plasmid#116276PurposeLentiviral expression of EGFR L858RDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-q-GFP
Plasmid#66080PurposeThis G protein alpha-q construct contains internal insertions of GFP and the EE epitopeDepositorInsertG protein alpha-q-EE-YFP (Gnaq Mouse)
TagsGFP was inserted internally into the alpha-q sequ…ExpressionMammalianMutationBamHI and SacI sites in alpha-q were removed with…PromoterCMVAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-IRF9
Plasmid#71452PurposeLentiviral expression of IRF9DepositorAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBabe puro H-Ras G12V Y40C
Plasmid#12276DepositorInsertH-Ras G12V Y40C (HRAS Human)
UseRetroviralExpressionMammalianMutationContains G12V activating mutation. The Y40C mutat…Available SinceJuly 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
P362-FBP_12
Plasmid#139703PurposeT-DNA encoding Fungal Bioluminescent Pathway Components, complete pathwayDepositorInsertpSlH4:NnCPH:tSlH4, p35S_Short_TMV 5':AsNpga:tAtug7, pAtuMas:NhH3H:tAtuMas, p35S:NnHisps:t35S, p35S:NnLuz:AtuOcs
UseLuciferaseExpressionPlantPromotervariousAvailable SinceMay 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
Halo-MTS
Plasmid#124315PurposeExpresses mitochondria specific HaloTag proteinDepositorInsertHalo tag
TagsMito specific seqExpressionMammalianPromoterCMVAvailable SinceMay 16, 2019AvailabilityAcademic Institutions and Nonprofits only