We narrowed to 12,361 results for: cel.2
-
Plasmid#179976PurposeMammalian expression vector for SARS-CoV-2 Nsp16, V5-tagged. Sequence codon-optimized.DepositorAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pCG_SARS-CoV2 ORF3a C-V5-tag
Plasmid#179980PurposeMammalian expression vector for SARS-CoV-2 ORF3a, V5-tagged. Sequence codon-optimized.DepositorAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCG_SARS-CoV2 NSP15 C-V5-tag
Plasmid#179975PurposeMammalian expression vector for SARS-CoV-2 Nsp15, V5-tagged. Sequence codon-optimized.DepositorAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCG_SARS-CoV2 NSP1 C-V5-tag
Plasmid#179972PurposeMammalian expression vector for SARS-CoV-2 Nsp1, V5-tagged. Sequence codon-optimized.DepositorAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJL1121
Plasmid#78188Purposeintestinal GFP expression by fasting in wormsDepositorAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
-
pMSCV-IRES-GFP-MyD88 (S34Y)-CpLxIS
Plasmid#131349PurposeExpresses MyD88 S34Y with 2 copies of pLxIS motif from STING fused to its C-terminusDepositorAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiPVe3_ChR2_mCherry (AAV PHP.eB)
Viral Prep#213941-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV_BiPVe3_ChR2_mCherry (#213941). In addition to the viral particles, you will also receive purified pAAV_BiPVe3_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the PV+ basket cell-targeting enhancer E3. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiPVe4_ChR2_mCherry (AAV PHP.eB)
Viral Prep#213937-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV_BiPVe4_ChR2_mCherry (#213937). In addition to the viral particles, you will also receive purified pAAV_BiPVe4_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the chandelier cell-targeting enhancer E4. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFRT/TO/HIS/FLAG/HA-MYEF2
Plasmid#38069DepositorAvailable SinceSept. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmAGO2-RC_B
Plasmid#145980PurposeInsect Expression of DmAGO2-RCDepositorInsertDmAGO2-RC (AGO2 Fly)
ExpressionInsectMutationA deletion of AA 51-56 and an insertion of 23 AA …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-S (P.1 lineage / Brazilian variant)
Plasmid#169847PurposeMammalian expression plasmid for S of SARS-CoV-2 (P.1 lineage / Brazilian variant) with N-terminal c-myc tagDepositorInsertProtein S
TagsHA leader and c-myc tagExpressionMammalianMutationCodon-optimized for human cell expression.PromoterCMVAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-S (B.1.1.7 lineage / UK variant)
Plasmid#169848PurposeMammalian expression plasmid for S of SARS-CoV-2 (B.1.1.7 lineage / UK variant) with N-terminal c-myc tagDepositorInsertProtein S
TagsHA leader and c-myc tagExpressionMammalianMutationCodon-optimized for human cell expression.PromoterCMVAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_erGAP3
Plasmid#78118PurposeLow affinity fluorescent calcium indicator of the GAP (GFP-Aequorin Protein) family targeted to the endoplasmic reticulumDepositorInserterGAP3
TagsKDEL and calreticulin signal peptideExpressionMammalianMutationS175G, D180Y, I167V and L15Q in GFP moiety and D…PromoterCMVAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
CRY-Gal∆DD (B1013)
Plasmid#92035PurposeExpresses CRY2 (full-length, with endogenous NLS) fused to Gal4 (aa1-65 of Gal4BD), downstream of mCherry-IRESDepositorInsertCRY2 (CRY2 Mustard Weed)
ExpressionMammalianMutationFusion of plant CRY2 to Gal4 binding domain (AA1-…Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only