We narrowed to 9,121 results for: set
-
Plasmid#86195PurposeU6 based expression of N meningitidis sgRNADepositorInsertnmCas9 sgRNA cloning cassete
UseLentiviralPromoterU6Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFNC-2
Plasmid#227667PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. KmR, easily curable via sucrose counterselection.DepositorInsertKmR
ExpressionBacterialAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFNC-4
Plasmid#227668PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. SmR, easily curable via sucrose counterselection.DepositorInsertSmR
ExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC2-gephyrin C3
Plasmid#199610PurposeEncodes N-terminal eGFP-tagged gephyrin including the C3 splice cassette for expression in mammalian cells.DepositorInsertGephyrin (Gphn Rat)
TagsEGFPExpressionMammalianMutationC3 cassette insertionPromoterCMVAvailable SinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC2-gephyrin C4a
Plasmid#199611PurposeEncodes N-terminal eGFP-tagged gephyrin including the C4a splice cassette for expression in mammalian cells.DepositorInsertGephyrin (Gphn Rat)
TagsEGFPExpressionMammalianMutationC4a casette insertionPromoterCMVAvailable SinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTW045
Plasmid#185690PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAsDepositorInsertCas9, Drm1b gRNAs
UseCRISPRExpressionPlantAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTW037
Plasmid#185688PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAsDepositorInsertCas9, Drm1b gRNA
UseCRISPRExpressionPlantAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjPLP1e5-S253T
Plasmid#129755PurposeGene targeting in marmoset cellsDepositorAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjPLP1e5-P216S
Plasmid#129754PurposeGene targeting in marmoset cellsDepositorAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjPLP1e2-P15L-_lox
Plasmid#129756PurposeGene targeting in marmoset cellsDepositorAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjPLP1e1-EGFP
Plasmid#129751PurposeGene targeting in marmoset cellsDepositorAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
SUPERBLADE5
Plasmid#134913PurposeEmpty backbone for cloning sgRNA sequence to be used in nanoblades system (Optimized for increased genome editing efficiency via Chen B et al., 2013)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyPromoterU6Available SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
BLADE-182
Plasmid#134914PurposesgRNA targeting GFP to be used in nanoblade systemDepositorInsertGFP
UseCRISPR and Synthetic BiologyPromoterU6Available SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSUC2::GNSI (NrsR)
Plasmid#121537PurposeThis plasmid contains a CYC1pr driven GNSI reporter and flanking homology to SUC2. Digestion with NotI, SacI, and EcoRV, allows integration at the SUC2 locus.DepositorInsertsCYC1 Promoter (CYC1 Budding Yeast)
Nyv1 Cytosolic Domain (aa 6-230)
Snc1 Transmembrane Domain (TMD)
SUC2 CDS
SUC2 terminator
NrsR
TagsmGFP5ExpressionYeastMutationM109I (Naturally occurring SNP) and The first 21 …Available SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only