We narrowed to 1,679 results for: αGFP
-
Plasmid#248662PurposeExpresses a soma-targeted GtACR2 in Flp-expressing cells under the EF1a promoter for neuronal inhibition.DepositorInsertstGtACR2
UseAAVTagsKv2.1 (C terminal on insert) and eGFPExpressionMammalianPromoterEF1aAvailable sinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJC2734 - pHR-EF1A-HA-FBXO31(D334N)-IRES-GFP
Plasmid#250266PurposecDNA expression of affinity-tagged FBXO31 (HA-FBXO31(D334N)).DepositorInsertFBXO31 (FBXO31 Human)
UseLentiviralTagsHAExpressionMammalianMutationD334NPromoterEF-1aAvailable sinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJC2732 - pHR-EF1A-HA-FBXO31(∆F-box)-IRES-GFP
Plasmid#250264PurposecDNA expression of affinity-tagged FBXO31 (HA-FBXO31(∆F-box)).DepositorInsertFBXO31 (FBXO31 Human)
UseLentiviralTagsHAExpressionMammalianMutation∆F-boxPromoterEF-1aAvailable sinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJC2737 - pHR-EF1A-DD-3xFLAG-FBXO31-IRES-GFP
Plasmid#250268PurposeInducible expression of FBXO31 with the shield degron system.DepositorAvailable sinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-TRIP12-391-938-EGFP-Hygro
Plasmid#238092PurposeExpression of structurally predicted WWE domain of TRIP12 with EGFP on C terminalDepositorInsertTRIP12 (TRIP12 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationaa 319-938 onlyPromoterEF1alphaAvailable sinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-XL1/BRCT1-Linker-eGFP
Plasmid#176084PurposeEGFP fused to the C-terminus of a XL1/BRCT1 domain & a hygromycin resistance cassetteDepositorAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GFP-EBA175-Flag(E1418K/P1424Q/Y1426S)
Plasmid#155006PurposeExpresses N-terminally GFP-tagged and C-terminally Flag-tagged EBA175 E1418K/P1424Q/Y1426S variant (residues 1284-1462) from pcDNA3.1DepositorInsertPfEBA175
TagsFlag, GFP, and signal peptide (residues 1 to 32) …ExpressionMammalianMutationE1418K/P1424Q/Y1426S; insert codes for EBA175 res…PromoterCMVAvailable sinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GFP-EBA175-Flag(M1423R/P1424V/Y1426H)
Plasmid#155312PurposeExpresses N-terminally GFP-tagged and C-terminally Flag-tagged EBA175 M1423R/P1424V/Y1426H variant (residues 1284-1462) from pcDNA3.1DepositorInsertPfEBA175
TagsFlag, GFP, and signal peptide (residues 1 to 32) …ExpressionMammalianMutationM1423R/P1424V/Y1426H; insert codes for EBA175 res…PromoterCMVAvailable sinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GFP-EBA175-Flag(A1419R/P1424Q/Y1426S)
Plasmid#155007PurposeExpresses N-terminally GFP-tagged and C-terminally Flag-tagged EBA175 A1419R/P1424Q/Y1426S variant (residues 1284-1462) from pcDNA3.1DepositorInsertPfEBA175
TagsFlag, GFP, and signal peptide (residues 1 to 32) …ExpressionMammalianMutationA1419R/P1424Q/Y1426S; insert codes for EBA175 res…PromoterCMVAvailable sinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GFP-EBA175-Flag(S1421R/P1424Q/Y1426S)
Plasmid#155008PurposeExpresses N-terminally GFP-tagged and C-terminally Flag-tagged EBA175 S1421R/P1424Q/Y1426S variant (residues 1284-1462) from pcDNA3.1DepositorInsertPfEBA175
TagsFlag, GFP, and signal peptide (residues 1 to 32) …ExpressionMammalianMutationS1421R/P1424Q/Y1426S; insert codes for EBA175 res…PromoterCMVAvailable sinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GFP-BAEBL (I1134V/P1135L/Y1136V/F1137V)
Plasmid#154875PurposeExpresses N-terminally GFP-tagged Pf-BAEBL P5-P2 VLVV variant (coding for residues 1041-1210) from pcDNA3.1DepositorInsertPfBAEBL (PF3D7_0506900 P. falciparum)
TagsGFP and signal peptide (residues 1 to 32) from TG…ExpressionMammalianMutationI1134V, P1135L, Y1136V, F1137V; insert codes for …PromoterCMVAvailable sinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GFP-EBA175-Flag(P1424I/Y1425I/Y1426I)
Plasmid#154977PurposeExpresses N-terminally GFP-tagged and C-terminally Flag-tagged EBA175 P1424A/Y1425I/Y1426I variant (residues 1284-1462) from pcDNA3.1DepositorInsertPfEBA175
TagsFlag, GFP, and signal peptide (residues 1 to 32) …ExpressionMammalianMutationP1424/Y1425I/Y1426I; insert codes for EBA175 resi…PromoterCMVAvailable sinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-vsv-Incenp d543-746-GFP
Plasmid#108503Purposeinducible expression of vsv-INCENP d543-746-EGFPDepositorInsertINCENP d543-746 (INCENP Human)
TagsEGFP and VSVExpressionMammalianMutationdelta alpha helixPromoterCMVAvailable sinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1a-Neuromodulin-IRES-Puromycin
Plasmid#134666PurposeExpresses EGFP-tagged plasma membrane markerDepositorAvailable sinceMarch 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
Antibody#237802-rAbPurposeAnti-Neurexin-1a (Mouse) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for human and mouse NRXN1a. Weak cross-reactivity to other NRXNs.DepositorPublicationRecommended applicationsImmunocytochemistryReactivityHuman and MouseSource speciesRabbitIsotypeIgGTrial sizeNot available to purchaseAvailable sinceFeb. 19, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits
-
TRUPATH Triple Ga15
Plasmid#196060PurposeEncodes a G alpha subunit (GNA15) with RLuc8, a G gamma subunit (GNG13) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gagust
Plasmid#196054PurposeEncodes a G alpha subunit (GNAT3) with RLuc8, a G gamma subunit (GNG1) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJC2735 - pHR-EF1A-HA-FBXO31(∆F-box, D334N)-IRES-GFP
Plasmid#250267PurposecDNA expression of affinity-tagged FBXO31 (HA-FBXO31(∆F-box, D334N)).DepositorInsertFBXO31 (FBXO31 Human)
UseLentiviralTagsHAExpressionMammalianMutation∆F-box, D334NPromoterEF-1aAvailable sinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJC2733 - pHR-EF1A-HA-FBXO31(∆F-box, T343V)-IRES-GFP
Plasmid#250265PurposecDNA expression of affinity-tagged FBXO31 (HA-FBXO31(∆F-box, T343V)).DepositorInsertFBXO31 (FBXO31 Human)
UseLentiviralTagsHAExpressionMammalianMutation∆F-box, T343VPromoterEF-1aAvailable sinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only