Skip to main content
Addgene
Showing: 1 - 20 of 34 results
  1. Fluorescent Proteins 101: GFP Fusion Proteins - Making the Right Connection

    Type
    Blog Post
    ...the limitations is the size of GFP: ~240 amino acids or about 28 kDa. GFP and its homologues have a beta-barrel...and shape matters The green fluorescent protein (GFP) from Aequorea victoria and its variants are genetically...interference is known as steric hindrance. For instance, GFP may occlude catalytic sites or obstruct binding sites...post-translational modifications. Despite these potential issues, GFP has been used successfully in countless fusion proteins... an inert light emitting module, any tendency of GFP to homodimerize should be avoided because it will...the linker sequence short In the early days of GFP applications, many were concerned with steric hindrance...fluorescent proteins derived from Aequorea victoria GFP sticks out and can be considered a linker (figure...
  2. SunTag and Fluorescent Imaging

    Type
    Blog Post
    ...al. observed some GFP aggregation, which they reduced by using superfolder GFP (sfGFP) with the small solubility...scaffold fully occupied with GFP has a molecular weight of 1,400 kDa vs 24 kDa for GFP alone. Although traditional...nomenclature throughout the rest of this blog post, GFP refers to sfGFP-GB1.   Tanenbaum et al. examined the power... copies of the short epitope GCN4. GCN4 recruits GFP fused to the cognate scFV antibody, which is expressed...physiology. Having seen that mitochondrial tracker GFP-mitoNEET can impair mitochondrial function, they ...they examined the effects of mitoNEET-SunTag-GFP. As expected, they obtained bright images of mitochondria... al. modified the GCN4 sequence to increase its alpha-helical structure and stability, creating v4 SunTag...
  3. Split Fluorescent Proteins for Studying Protein-Protein Interactions

    Type
    Blog Post
    ...Chang-Deng Hu Green sfGFP Split super-folder GFP, our most-requested GFP(1-10) and GFP(11) Versatile protein...Commun. 2016 Bo Huang spGFP Split superpositive GFP Split-superpositive GFP reassembly is a fast, efficient...base FP (for example, EBFP2(1-10) can be used with GFP(11)). Some of the articles linked below only provide...Blue EBFP2 EBFP2(1-10) and Capri(1-10) for use with GFP(11) Multiplexed labeling of cellular proteins with... Kamiyama Cerulean Cerulean(1-10) for use with GFP(11) Multiplexed labeling of cellular proteins with... high-throughput screen for molecules affecting alpha-synuclein oligomerisation. Eastwood T, Baker K, ...background signal (especially for some older split-GFP constructs or certain cell environments). Also consider...
  4. Fluorescent Proteins 101: When GFP lets you down

    Type
    Blog Post
    ...S65T) in the original jellyfish GFP (AvGFP) to create enhanced GFP (EGFP), a variant with improved brightness... There are numerous GFP variants. Here I use the name ‘GFP’, which refers to mEGFP. This variant was made...examined on a case-by-case basis. GFP is sensitive to acid The chromophore of GFP can exist in a protonated and...its acid tolerance is maintained in cells.   GFP is big GFP is a 28 kDa protein that resembles a cylinder...2013; Hilaire et al., 2017). GFP can only be used for tagging proteins GFP fusion proteins are made by ... a fusion with GFP allows for detection of genomic locations (Chen et al., 2013). GFP fluorescence overlaps... al., 2018). GFP is not tolerated in my fusion It is standard practice to attach the GFP to the N- or ...
  5. New Norepinephrine Indicators: nLightG and nLightR

    Type
    Blog Post
    ...., 2023. nLight nLight sensors are based on alpha-1a adrenergic receptor; nLightG contains circularly...circularly permuted green fluorescent protein (GFP), and nLightR uses a red fluorescent protein, mApple. Kagiampaki...blocked by alpha2-AR antagonist, nLight sensors are not. Instead, they are blocked by alpha1-AR antagonist...antagonist. This is important because alpha2-AR can provide inhibitory feedback in response to norepinephrine...multiplexing in experiments, including ones that study alpha2-AR. Selectivity Norepinephrine and dopamine are...
  6. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ... Gerlich 25999 LV-GFP Chromatin H2B GFP Elaine Fuchs 11680 H2B-GFP Chromatin H2B GFP Geoff Wahl 21210 ...Microtubules alpha-tubulin mCherry* Michael Davidson 12298 pIRESneo-EGFP-alpha Tubulin Microtubules alpha-tubulin...Beta-catenin GFP Adherens Junctions Beta-catenin EGFP Alpha Yap 67937 mouse E-cadherin GFP (423) Adherens...61803 GFP-Rab7A Late endosomes Rab7a AcGFP Gia Voeltz 12605 GFP-rab7 WT Late endosomes RAB7 GFP Richard...St-Pierre 49149 mCh-alpha-tubulin Microtubules alpha-tubulin mCherry Gia Voeltz 89472 GFP-hChibby1 Mother ...Brown 11908 pEGFP-N1 alpha-actinin 1 Actin Filaments alpha-actinin 1 EGFP Carol Otey 27676 Cortactin-pmCherryC1... Huttenlocher 11908 pEGFP-N1 alpha-actinin 1 Focal Adhesions alpha-actinin 1 EGFP Carol Otey 31923 pPaxillin-PSmOrange...
  7. Understanding GPCR Signaling Using TRUPATH

    Type
    Blog Post
    ...complex consists of a trimer of three subunits: alpha, beta, and gamma (Gα, Gβ, and Gγ), collectively ...transfer 2, or BRET2. With binding of the drug, the alpha and beta subunits dissociate resulting in decreased... acceptor GFP2-Gγ chimeras, and two untagged Gβ constructs. For the Gγ constructs, the GFP2 tag is fused... Gα-Rluc8 and Gγ-GFP2 will be in close association, resulting in a high level of GFP2 emission. Following...interest, a Gα-Rluc8 plasmid, and the appropriate Gγ-GFP2 and Gβ constructs. Cells are then treated with the...complex will disassociate, resulting in a decreased GFP2 emission. The activation state can be measured by... by a BRET2 ratio, which is the ratio of GFP2 emission to RLuc8 emission (see figure). What can TRUPATH...
  8. Hot Plasmids: Summer 2024

    Type
    Blog Post
    ...bundle; SAH: 60-nm single alpha helix) and target capture module (SpyTag-GFP nanobody) assembled on beads...In MagIC-cryo-EM, target proteins (expressed as a GFP fusion in this proof-of-concept study) are captured...SpyTag-SpyCatcher linkers and spacer proteins ending with a GFP nanobody (Figure 1). This enrichment streamlines ...beads. C) Micrograph of H1.8-GFP nucleosomes collected with MagIC-cryo-EM. Nucleosome-like particles identified...) 3D model of the obtained structure of the H1.8-GFP-bound nucleosome. Images adapted from Arimura et ...
  9. Cre-lox system

    Type
    Collection
    ...48201 CAG-GFP-IRES-CRE Cre and GFP coexpression CAG Retroviral Gage 49054 CAG-GFP/cre Cre-GFP fusion CAG...116879 CAG-Cremyc-2A-GFP GFP and Cre CAG Mammalian Lu 117148 Hiv7CMV-Cremyc-2A-GFP GFP and Cre CMV Lentiviral...iRFP670-EFS:Cre-2A-GFP iRFP670, Cre, and GFP TRE Mammalian Jacks 68544 AAV-Cre-GFP Cre CMV AAV Nestler... on GFP (CRE-DOG) EF-1 alpha AAV Cepko 69571 pAAV-EF1a-C-CreintG Cre recombinase dependent on GFP (CRE-DOG...pBS500 EF1alpha-GFPcre Cre-GFP fusion EF-1 alpha Mammalian Sauer 11923 pBS598 EF1alpha-EGFPcre Cre-EGFP...fusion EF-1 alpha Mammalian Sauer 11955 pBS505 EF1alpha-EGFPcre* Cre-EGFP fusion EF-1 alpha Mammalian Sauer...11918 pBS513 EF1alpha-cre Cre EF-1 alpha Mammalian Sauer 11919 pBS448 RSV-GFPcre Cre-GFP fusion Rous sarcoma...
  10. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...GAL 72Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15583 GAL 103Q+ProGFPp416 HTT GFP GAL1 Huntington's...
  11. Plasmids 101: The Promoter Region – Let's Go!

    Type
    Blog Post
    ...mammalian expression from human elongation factor 1 alpha Constitutive  Tends to give consistent expression...Vectors Read about Reporter Gene like Luciferase and GFP Resources on Addgene.org Find Plasmids for Your...
  12. New and Upcoming Viral Vectors - May 2020

    Type
    Blog Post
    ...respectively of a GFP dependent Cre. The two segments come together in the presence of GFP to form a functional... activation to cells expressing both Cre and GFP. The GFP dependent FLPo, Flp-DOG (75469), is also available...-2 proteins ChR2 for targeted expression DREADDs GFP dependent Cre and FLPo And more!  New lentiviral...in new serotypes, as well as a new Cre dependent GFP control plasmid for expression in forebrain GABA-...Karl Deisseroth 83895 AAVrg pAAV-hDlx-Flex-GFP-Fishell_6 Gordon Fishell   Optogenetics Optogenetics...transgenic reporter lines that supply a variety of GFP expression patterns, thus allowing you to further...AAV2 pAAV-Ef1a-fDIO mCherry 83900 AAVrg pAAV-mDlx-GFP-Fishell-1 Biosensors Plasmid Serotype Name ...
  13. Validated gRNA Sequences

    Type
    Collection
    ...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...Moffat AMPK alpha 1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens...Shaw AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...
  14. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...both the GFP and the RFP proteins in the nucleus. During the first round of translation, the GFP proteins...-Sec61 beta BFP-KDEL Rtn4a-GFP (tubular ER) Microtubules mCherry-alpha-tubulin Early Endosome ...Compartment mCherry-Rab5 BFP-Rab5 GFP-Rab5B Vacuolar & Budding Compartment GFP-Rab4B Mitochondria mito-BFP...GTPase in division) GFP-Mff (outer membrane protein) Late Endosome mCherry-Rab7A GFP-Rab7A     ...protein Knock-off, is made up of three components: a GFP protein that binds to the coding region of a reporter...reporter mRNA via a PP7 coat protein (NLS-PCP-GFP) a RFP protein that binds to the 3’ UTR of the reporter...these dCas9s with one of three fluorescent proteins (GFP, BFP and mCherry), the authors were able to visualize...
  15. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...87420 PXN-EGFP AICSDP-1 EGFP Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP AICSDP-4 mEGFP Alpha-tubulin ...AICSDP-28 mTagRFP-T Alpha-tubulin Microtubules 101786 ST6GAL1-mEGFP AICSDP-26 mEGFP Sialyltransferase 1...AICSDP-63 mEGFP Alpha-actinin-2 Sarcomeric z-disks 124608 NPM1-mTagRFP-T AICSDP-69 mTagRFP-T Nucleophosmin...87422 LMNB1-mEGFP AICSDP-10 mEGFP Lamin B1 Nuclear envelope 87423 TOMM20-mEGFP AICSDP-8 mEGFP Tom20 Mitochondria...Mitochondria 87424 DSP-mEGFP AICSDP-9 mEGFP Desmoplakin Desmosomes 87425 ACTB-mEGFP AICSDP-15 mEGFP Beta-actin Actin... SEC61B-mEGFP AICSDP-7 mEGFP Sec61 beta Endoplasmic reticulum 87427 FBL-mEGFP AICSDP-13 mEGFP Fibrillarin...101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP-1 Lysosome 101783 MAP1LC3B-mEGFP AICSDP-25 mEGFP Autophagy-related...
  16. Lentivirus Plasmids

    Type
    Collection
    ...hUbC-driven EGFP; can be used for cDNA expression Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA ...17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP as a reporter....reporter. See plasmid 17618 for GFP plasmid. Cheng 17452 pLenti CMV Puro DEST 3rd Gateway destination plasmid...plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-expression. See plasmid...expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion; can be used for cDNA expression...Trono 12254 pWPI 2nd EF-1alpha driven constitutive transgene expression and EGFP coexpression. Trono 17619...other versions of pULTRA. Moore 19319 pLJM1-EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895...
  17. CRISPR 101: Epigenetics and Editing the Epigenome

    Type
    Blog Post
    ...Methyltransferase 3 Alpha (DNMT3A) Vlatka Zoldoš’ lab has deposited pdCas9-DNMT3A-EGFP and pdCas9-DNMT3A-PuroR...methylation in mammalian cells. Co-expression markers EGFP and PuroR enable sorting and selection of transduced...Goodell's lab has deposited pcDNA3.1-dCas9-MQ1(Q147L)-EGFP, a fusion of dCas9 to a small DNA methyltransferase...epigenome-editing tools. pLV hUbC-dCas9-MQ1(Q147L)-EGFP is also available for lentiviral transduction. Lysine-specific...
  18. Sequencing Primers

    Type
    Guide
    ...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...promoter, forward primer Alpha-factor TACTATTGCCAGCATTGCTGC (Invitrogen) Alpha factor signal sequence, ...terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F...CCATCTAATTCAACAAGAATTGGGACAAC (Ahmad lab) 5' end of GFP, reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae...reverse primer XEF1a TTTCGCCCTAACTTCGTGAT Xenopus EF1 alpha enhancer/promoter, forward primer Xpress Forward...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...end of EGFP, reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP...
Showing: 1 - 20 of 34 results