Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 17 results for: αGFP

Clear keywords
Showing: 1 - 17 of 17 results

  1. Fluorescent Proteins 101: GFP Fusion Proteins - Making the Right Connection

    Type
    Blog Post
    ...the limitations is the size of GFP: ~240 amino acids or about 28 kDa. GFP and its homologues have a beta-barrel...and shape matters The green fluorescent protein (GFP) from Aequorea victoria and its variants are genetically...interference is known as steric hindrance. For instance, GFP may occlude catalytic sites or obstruct binding sites...post-translational modifications. Despite these potential issues, GFP has been used successfully in countless fusion proteins... an inert light emitting module, any tendency of GFP to homodimerize should be avoided because it will...Keep the linker sequence short In the early days of GFP applications, many were concerned with steric hindrance...fluorescent proteins derived from Aequorea victoria GFP sticks out and can be considered a linker (figure...

  2. Fluorescent Proteins 101: When GFP lets you down

    Type
    Blog Post
    ...discussed below. There are numerous GFP variants. Here I use the name ‘GFP’, which refers to mEGFP. This variant..., S65T) in the original jellyfish GFP (AvGFP) to create enhanced GFP (EGFP), a variant with improved brightness...examined on a case-by-case basis. GFP is sensitive to acid The chromophore of GFP can exist in a protonated and...its acid tolerance is maintained in cells.   GFP is big GFP is a 28 kDa protein that resembles a cylinder...2013; Hilaire et al., 2017). GFP can only be used for tagging proteins GFP fusion proteins are made by ... a fusion with GFP allows for detection of genomic locations (Chen et al., 2013). GFP fluorescence overlaps... al., 2018). GFP is not tolerated in my fusion It is standard practice to attach the GFP to the N- or ...

  3. SunTag and Fluorescent Imaging

    Type
    Blog Post
    ...et al. observed some GFP aggregation, which they reduced by using superfolder GFP (sfGFP) with the small...scaffold fully occupied with GFP has a molecular weight of 1,400 kDa vs 24 kDa for GFP alone. Although traditional...In biology as in life, more is often better. More transcription factor binding sites in a promoter lead... copies of the short epitope GCN4. GCN4 recruits GFP fused to the cognate scFV antibody, which is expressed...nomenclature throughout the rest of this blog post, GFP refers to sfGFP-GB1.   Tanenbaum et al. examined ...physiology. Having seen that mitochondrial tracker GFP-mitoNEET can impair mitochondrial function, they ...they examined the effects of mitoNEET-SunTag-GFP. As expected, they obtained bright images of mitochondria...

  4. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ... Gerlich 25999 LV-GFP Chromatin H2B GFP Elaine Fuchs 11680 H2B-GFP Chromatin H2B GFP Geoff Wahl 21217 ...Microtubules alpha-Tubulin mCherry* Michael Davidson 12298 pIRESneo-EGFP-alpha Tubulin Microtubules alpha-Tubulin...Beta-catenin GFP Adherens junctions beta-Catenin EGFP Alpha Yap 67937 mouse E-cadherin GFP (423) Adherens...61803 GFP-Rab7A Endosomes (late) Rab7a AcGFP Gia Voeltz 12605 GFP-rab7 WT Endosomes (late) RAB7 GFP Richard...emiRFP703 Vladislav Verkhusha 17650 GFP-HP1gamma Chromatin HP1 gamma GFP Tom Misteli 55068 mCherry-LaminA-C...118736 pBOB-CARMIL2 BH domain-GFP Plasma membrane CARMIL2 BH domain GFP John Cooper 118737 pBOB-CARMIL2...EGFP Anthony Brown 11908 pEGFP-N1 alpha-actinin 1 Actin filaments alpha-Actinin 1 EGFP Carol Otey 27676 ...

  6. Split Fluorescent Proteins for Studying Protein-Protein Interactions

    Type
    Blog Post
    ...Green sfGFP Split super-folder GFP, our most-requested GFP(1–10) and GFP(11) Versatile protein tagging ... Huang spGFP Split superpositive GFP Split-superpositive GFP reassembly is a fast, efficient, and ...base FP (for example, EBFP2(1–10) can be used with GFP(11)). Some of the articles linked below only provide... EBFP2 EBFP2(1–10) and Capri(1–10) for use with GFP(11) Multiplexed labeling of cellular proteins with...Kamiyama Cerulean Cerulean(1–10) for use with GFP(11) Multiplexed labeling of cellular proteins with... high-throughput screen for molecules affecting alpha-synuclein oligomerisation. Eastwood et al. FEBS ...background signal (especially for some older split-GFP constructs or certain cell environments). Also consider...

  8. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...1177 p416 25Q GPD HTT GFP GPD Huntington's Susan Lindquist 1178 p416 46Q GPD HTT GFP GPD Huntington's Susan...1179 p416 72Q GPD HTT GFP GPD Huntington's Susan Lindquist 1180 p416 103Q GPD HTT GFP GPD Huntington's Susan...1181 p426 25Q GPD HTT GFP GPD Huntington's Susan Lindquist 1182 p426 46Q GPD HTT GFP GPD Huntington's Susan...1183 p426 72Q GPD HTT GFP GPD Huntington's Susan Lindquist 1184 p426 103Q GPD HTT GFP GPD Huntington's Susan...

  9. New Norepinephrine Indicators: nLightG and nLightR

    Type
    Blog Post
    ...., 2023. nLight nLight sensors are based on alpha-1a adrenergic receptor; nLightG contains circularly...circularly permuted green fluorescent protein (GFP), and nLightR uses a red fluorescent protein, mApple. Kagiampaki...

  10. Hot Plasmids: Summer 2024

    Type
    Blog Post
    ...bundle; SAH: 60-nm single alpha helix) and target capture module (SpyTag-GFP nanobody) assembled on beads...In MagIC-cryo-EM, target proteins (expressed as a GFP fusion in this proof-of-concept study) are captured...SpyTag-SpyCatcher linkers and spacer proteins ending with a GFP nanobody (Figure 1). This enrichment streamlines ...beads. C) Micrograph of H1.8-GFP nucleosomes collected with MagIC-cryo-EM. Nucleosome-like particles identified...) 3D model of the obtained structure of the H1.8-GFP-bound nucleosome. Images adapted from Arimura et ...

  11. Hot Plasmids: May 2026

    Type
    Blog Post
    ...sensors consist of the alpha-1a adrenergic receptor fused with a circularly permuted GFP (nLightG/nLightG2)...

  12. Plasmids 101: The Promoter Region – Let's Go!

    Type
    Blog Post
    ...mammalian expression from human elongation factor 1 alpha Constitutive  Tends to give consistent expression...Vectors Read about Reporter Gene like Luciferase and GFP Resources on Addgene.org Find Plasmids for Your...

  13. Sequencing Primers

    Type
    Guide
    ...activation domain Forward GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP Forward GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC Alpha factor signal sequence Forward...CCATCTAATTCAACAAGAATTGGGACAAC 5' end of GFP Reverse GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter Forward GW... Reverse XEF1a TTTCGCCCTAACTTCGTGAT Xenopus EF1 alpha enhancer/promoter Forward Xpress Forward TATGGCTAGCATGACTGGT...

  14. Lentivirus Plasmids

    Type
    Collection
    ...Sabatini 171123 pLVX-TetOne-Puro-GFP 3rd Dox-inducible expression of GFP. Jason Sheltzer 20342 FUW-M2rtTA...expression. David Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA under the control of a tet-responsive H1...coexpression. Didier Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression...expression of RFP as a reporter. See plasmid 17618 for GFP reporter. Linzhao Cheng 17452 pLenti CMV Puro DEST ...Kevin Brindle and Duncan Jodrell 17448 pLenti CMV GFP Puro (658-5) 3rd eGFP expression with CMV promoter...

  15. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...both the GFP and the RFP proteins in the nucleus. During the first round of translation, the GFP proteins...-Sec61 beta BFP-KDEL Rtn4a-GFP (tubular ER) Microtubules mCherry-alpha-tubulin Early Endosome ...Compartment mCherry-Rab5 BFP-Rab5 GFP-Rab5B Vacuolar & Budding Compartment GFP-Rab4B Mitochondria mito-BFP...GTPase in division) GFP-Mff (outer membrane protein) Late Endosome mCherry-Rab7A GFP-Rab7A     ...protein Knock-off, is made up of three components: a GFP protein that binds to the coding region of a reporter...reporter mRNA via a PP7 coat protein (NLS-PCP-GFP) a RFP protein that binds to the 3’ UTR of the reporter...these dCas9s with one of three fluorescent proteins (GFP, BFP and mCherry), the authors were able to visualize...

  16. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...199419 Anti-GFP [N86/38R-2b] GFP Aequorea victoria Mouse IgG2b 199420 Anti-GFP [N86/8R-2b] GFP Aequorea ...206719 Anti-GFP [N86/38R-1] GFP Aequorea victoria Mouse IgG2a 206720 Anti-GFP [N86/8R-1] GFP Aequorea victoria...Rat Mouse 206743 GFP scFv [N86/44] N86/44 scFv GFP Aequorea victoria Mouse 206744 GFP scFv [N86/20] N86...short and long Rat Mouse IgG2a 114492 Anti-GFP [N86/38.1R] GFP Aequorea victoria Mouse IgG2a 114493 Anti-NGL...glutamate receptor Rat Mouse IgG2a 177572 Anti-GFP [N86/8R] GFP Aequorea victoria Mouse IgG2a 177573 Anti-...N479/107R] VAPA/B Mouse IgG2a 188164 Anti-GFP [N86/44R] GFP Aequorea victoria Mouse IgG2a 188165 Anti-.../22R] Prrt2 Mouse Mouse IgG2a 188166 Anti-GFP [N86/20R] GFP Aequorea victoria Mouse IgG2a 188167 Anti-...

  17. Neurodegeneration Research Collection

    Type
    Collection
    ...construct for subcellular localization studies with GFP, or IP with Flag tag. (Bennett et al. Heliyon. 2020...al. Neuron. 2010) Express EGFP-tagged wt and mt Alpha-synuclein . (Furlong et al. Biochem J. 2000) Other...
Showing: 1 - 17 of 17 results