Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Showing: 1 - 20 of 55 results
  1. Fluorescent Proteins 101: GFP Fusion Proteins - Making the Right Connection

    Type
    Blog Post
    Updated
    Dec. 23, 2019, 2:33 a.m.
    ...experience, the best site for the insertion is a loop in between secondary structure (beta-sheets or alpha...successful insertion of a fluorescent protein are the tagging of Ccd42 (Bendezú et al., 2015) and the alpha...GFP and its homologues have a beta-barrel structure....One of the limitations is the size of GFP: ~240 amino acids or about 28 kDa....Despite these potential issues, GFP has been used successfully in countless fusion proteins....For instance, GFP may occlude catalytic sites or obstruct binding sites or motifs that are necessary...Keep the linker sequence short In the early days of GFP applications, many were concerned with steric...In fact, for several FRET biosensors (yellow cameleon 3.60, EPAC, and Galphai), the C-terminus and N-terminus...
  2. Plasmids 101: SunTag and Fluorescent Imaging

    Type
    Blog Post
    Updated
    Oct. 20, 2019, 9:08 p.m.
    ...To increase expression, Tanenbaum et al. modified the GCN4 sequence to increase its alpha-helical structure...gfp...Initially, Tanenbaum et al. observed some GFP aggregation, which they reduced by using superfolder GFP...the effects of mitoNEET-SunTag-GFP....has a molecular weight of 1,400 kDa vs 24 kDa for GFP alone....In SunTag nomenclature throughout the rest of this blog post, GFP refers to sfGFP-GB1.  ...GCN4 recruits GFP fused to the cognate scFV antibody, which is expressed from a separate plasmid....In SunTag nomenclature throughout the rest of this blog post, GFP refers to sfGFP-GB1.  ...(sfGFP) with the small solubility tag GB1....
  3. Plasmids for Endogenous Gene Tagging in Human Cells

    Type
    Blog Post
    Updated
    Oct. 20, 2019, 8:53 p.m.
    ...87420 PXN-EGFP AICSDP-5 EGFP Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP AICSDP-12 mEGFP Alpha-tubulin...ve created and tested plasmids that use CRISPR/Cas9 to endogenously tag a wide variety of genes with GFP...For a C-terminal tag, as shown in the example above, we inserted a linker and GFP tag at the end of the...Plasmids, plasmids everywhere To date, we have created 10 plasmids that can be used to introduce a GFP...The whole segment—a GFP tag and 1kb of homologous DNA flanking both sides (about 2.7kb total)—is inserted...This results in the insertion of the GFP tag precisely where we need it, in this example, at the C-terminus...Matrix Adhesions 87421 TUBA1B-mEGFP AICSDP-12 mEGFP Alpha-tubulin Microtubules 87422 LMNB1-mEGFP...87424 DSP-mEGFP AICSDP-17 mEGFP Desmoplakin Desmosomes 87425 ACTB-mEGFP AICSDP-16 mEGFP Beta-actin...Actin 87426 SEC61B-mEGFP AICSDP-10 mEGFP Sec61-beta Endoplasmic Reticulum 87427 FBL-mEGFP...AICSDP-14 mEGFP Fibrillarin Nucleolus Coming Soon MYH10-mEGFP AICSDP-24 mEGFP Non-muscle myosin...AICSDP-13 mEGFP Nuclear laminB1 Nuclear envelope 87423 TOMM20-mEGFP AICSDP-11 mEGFP TOM20 Mitochondria...Addgene ID Plasmid Allen Institute ID Tag Protein Structure 87420 PXN-EGFP AICSDP-5 EGFP Paxillin...heavy chain IIB Actomyosin bundles 87429  TJP1-mEGFP AICSDP-23 mEGFP Tight junction protein ZO1 Tight...
  4. Fluorescent Proteins 101: When GFP lets you down

    Type
    Blog Post
    Updated
    Dec. 14, 2019, 3:11 a.m.
    ...In this way, we (and others) have successfully generated several functional heterotrimeric G-alpha subunit...There are numerous GFP variants. Here I use the name ‘GFP’, which refers to mEGFP....GFP is big GFP is a 28 kDa protein that resembles a cylinder with a length of 4.2 nm and a diameter of...GFP can only be used for tagging proteins GFP fusion proteins are made by connecting its DNA code to...GFP is sensitive to acid The chromophore of GFP can exist in a protonated and a deprotonated state (Tsien...GFP is not tolerated in my fusion It is standard practice to attach the GFP to the N- or C-terminus of...GFP fluorescence overlaps with autofluorescence The cyan light that is used to excite GFP, may also excite...There are numerous GFP variants. Here I use the name ‘GFP’, which refers to mEGFP....to create enhanced GFP (EGFP), a variant with improved brightness (Tsien, 1998)....This variant was made by introducing two mutations (F64L, S65T) in the original jellyfish GFP (AvGFP)...Another mutation (A206K) is necessary to generate the strictly monomeric EGFP variant, mEGFP (Zacharias...
  5. Plasmids 101: The Promoter Region – Let's Go!

    Type
    Blog Post
    Updated
    Dec. 2, 2019, 1:42 p.m.
    ...EF1a General expression mRNA Strong mammalian expression from human elongation factor 1 alpha Constitutive...Browse All Plasmids 101 Posts Learn about Mammalian Vectors Read about Reporter Gene like Luciferase and GFP...
  6. New and Upcoming Viral Vectors - May 2020

    Type
    Blog Post
    Updated
    May 28, 2020, 1:15 p.m.
    ...The GFP dependent FLPo, Flp-DOG (75469), is also available in AAV1....few months: Lentiviral preps for expressing SARS-CoV-2 proteins ChR2 for targeted expression DREADDs GFP...now expanded to offer many of our control plasmids in new serotypes, as well as a new Cre dependent GFP...CRE-DOG constructs 69570 and 69571 together encode the N and C terminal segments respectively of a GFP...system takes advantage of the extensive supply of transgenic reporter lines that supply a variety of GFP...expression patterns, thus allowing you to further restrict gene activation to cells expressing both Cre and GFP...4 Controls Plasmid Serotype Name 114471 AAV2 pAAV-Ef1a-fDIO mCherry 83900 AAVrg pAAV-mDlx-GFP-Fishell...preps for expressing the E protein (pLVX-EF1alpha-SARS-CoV-2-E-2xStrep-IRES-Puro) and NSP2 (pLVX-EF1alpha-SARS-CoV...of the SARS-CoV-2 N protein  pLVX-EF1alpha-SARS-CoV-2-M-2xStrep-IRES-Puro: Expression of the SARS-CoV...The following lentiviral preps are now available: pLVX-EF1alpha-SARS-CoV-2-N-2xStrep-IRES-Puro: Expression...-2 M protein pLVX-EF1alpha-SARS-CoV-2-orf3a-2xStrep-IRES-Puro: Expression of the SARS-CoV-2 ORF3a Lentiviral...50457 AAV1 pAAV-hSyn-DIO-EGFP Bryan Roth 114472 AAVrg pAAV-hSyn-mCherry Karl Deisseroth 83895...
  7. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    Updated
    Nov. 20, 2019, 2:36 p.m.
    ...(tubular ER) Microtubules mCherry-alpha-tubulin Early Endosome Vacuolar Compartment mCherry-Rab5...(GTPase in division) GFP-Mff (outer membrane protein) Late Endosome mCherry-Rab7A GFP-Rab7A  ...BFP-Rab5 GFP-Rab5B Vacuolar & Budding Compartment GFP-Rab4B Mitochondria mito-BFP mCherry-Drp1...protein that binds to the coding region of a reporter mRNA via a PP7 coat protein (NLS-PCP-GFP) a RFP...By fusing these dCas9s with one of three fluorescent proteins (GFP, BFP and mCherry), the authors were...During the first round of translation, the GFP proteins that are bound to the coding region are displaced...Broccoli is an RNA aptamer that acts as a GFP mimetic and induces fluorescence in the presence of DHFBI...Co-expression of LOC8R-PSmOrange and LOC8R-PAGFP provides a novel strategy for assaying the dynamics...to the protein of interest are recognized and thus fluorescently labeled by scFv antibodies fused to sfGFP...
  8. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...Actin Filaments utrophin (aa# 1-261) GFP Bement pIRESneo-EGFP-alpha Tubulin Microtubules alpha-tubulin...mCherry* Davidson pDEST/N1-hEB1-GFP Microtubules EB1 GFP Shaw pmiRFP703-Tubulin Microtubules alpha-tubulin...EGFP Wadsworth pmTurquoise2-Tubulin Microtubules alpha-tubulin mTurquoise2 Gadella mCh-alpha-tubulin...Microtubules alpha-tubulin mCherry Voeltz pPAmCherry-b-actin Actin Filaments beta-actin PAmCherry1...Early endosomes Rab5B AcGFP Voeltz GFP-Rab4B Early endosomes Rab4B AcGFP Voeltz GFP-rab7 WT Late...Rab7a mCherry Voeltz GFP-Rab7A Late endosomes Rab7a AcGFP Voeltz GFP-rab11 WT Recycling endosomes...GFP Takemaru pLenti-EGFP-hChibby1 Mother Centrioles / Ciliary Base Chibby1 EGFP Takemaru GFP-hCCDC11...utrophin (aa# 1-261) GFP Bement pIRESneo-EGFP-alpha Tubulin Microtubules alpha-tubulin EGFP Wadsworth...alpha-tubulin PAmCherry Verkhusha EMTB-3XGFP Microtubules ensconsin GFP Bement EMTB-mCherry Microtubules...Microtubules alpha-tubulin mScarlet-I Gadella pmScarlet-H_alphaTubulin_C1 Microtubules alpha-tubulin...pmTurquoise2-Tubulin Microtubules alpha-tubulin mTurquoise2 Gadella mCh-alpha-tubulin Microtubules...mScarlet-H Gadella pmScarlet_alphaTubulin_C1 Microtubules alpha-tubulin mScarlet Gadella pLenti-EB1...alpha-tubulin mCherry Voeltz pPAmCherry-b-actin Actin Filaments beta-actin PAmCherry1 Verkhusha...
  9. Cre-lox system

    Type
    Collection
    ...dependent on GFP (CRE-DOG) EF-1 alpha AAV Cepko 69572 pCAG-N-CretrcintG Cre recombinase dependent...recombinase dependent on GFP (CRE-DOG) EF-1 alpha AAV Cepko 69571 pAAV-EF1a-C-CreintG Cre recombinase...Sauer 11920 pBS500 EF1alpha-GFPcre Cre-GFP fusion EF-1 alpha Mammalian Sauer 11923 pBS598 EF1alpha-EGFPcre...Cre-EGFP fusion EF-1 alpha Mammalian Sauer 11955 pBS505 EF1alpha-EGFPcre* Cre-EGFP fusion EF-1 alpha...1 alpha AAV Deisseroth 55638 pAAV-EF1a-vCre VCre EF-1 alpha AAV Deisseroth 59701 pRetroQ-Cre-ERT2...Cre and GFP coexpression CAG Retroviral Gage 49054 CAG-GFP/cre Cre-GFP fusion CAG Retroviral Gage...GFP and Cre CAG Mammalian Lu 117148 Hiv7CMV-Cremyc-2A-GFP GFP and Cre CMV Lentiviral Lu 118029...11923 pBS598 EF1alpha-EGFPcre Cre-EGFP fusion EF-1 alpha Mammalian Sauer 11955 pBS505 EF1alpha-EGFPcre.../promoter Mammalian Sauer 11920 pBS500 EF1alpha-GFPcre Cre-GFP fusion EF-1 alpha Mammalian Sauer...* Cre-EGFP fusion EF-1 alpha Mammalian Sauer 11956 pBS594 promoterless EGFPcre Cre-EGFP fusion in...Cre EF-1 alpha Mammalian Sauer 11919 pBS448 RSV-GFPcre Cre-GFP fusion Rous sarcoma virus (RSV) LTR...on GFP (CRE-DOG) EF-1 alpha AAV Cepko 69572 pCAG-N-CretrcintG Cre recombinase dependent on GFP (CRE-DOG...dependent on GFP (CRE-DOG) EF-1 alpha AAV Cepko 69571 pAAV-EF1a-C-CreintG Cre recombinase dependent...
  10. Michael Davidson Fluorescent Protein Collection

    Type
    Collection
    ..., Emission: 610mCherry-Alpha-Actin2-C-18 Data Supplement mCherry-Alpha-Actinin2-N-18Localization: Alpha...-Alpha-Actinin-C-14Localization: Alpha Actinin, Excitation: 505 / 569, Emission: 516 / 581mEos2-Alpha-Actinin-C.../Membrane, Excitation: 400 / 504, Emission: 515 / 517mPA-GFP-CD151-7 Data Supplement mPA-GFP-C-Src-...: 400 / 504, Emission: 515 / 517mPA-GFP-EB3-7 Data Supplement mPA-GFP-ER-3Localization: Endoplasmic...: 400 / 504, Emission: 515 / 517mPA-GFP-MannII-N-10 Data Supplement mPA-GFP-MAP4-C-10Localization:...mPA-GFP-MCHR1-N-10Localization: Cilium, Excitation: 400 / 504, Emission: 515 / 517mPA-GFP-MCHR1-N-.../ 504, Emission: 515 / 517mPA-GFP-MyosinIIA-C-18 Data Supplement mPA-GFP-Paxillin-22Localization:...-19Localization: Non-muscle Alpha Actinin, Excitation: 485, Emission: 507sfGFP-Alpha-Actinin-19 Data...507EGFP-Alpha-5-Integrin-10 Data Supplement EGFP-ER-14Localization: Endoplasmic Reticulum, Excitation...7 Data Supplement EGFP-Alpha-5-Integrin-10Localization: Focal Adhesions, Excitation: 488, Emission:...580, Emission: 515 mKind2-PDHA1-N-10Localization: Mitochondria, Excitation: 580, Emission: 515 EGFP-BaxAlpha-C...20Localization: Lysosome Membrane, Excitation: 487, Emission: 509Emerald-Lysosomes-20 Data Supplement sfGFP-Alpha-Actinin...: 516 / 581tdEos-Alpha-Actinin-19 Data Supplement tdEos-Alpha-Actinin2-N-18Localization: Alpha Actinin...
  11. CRISPR 101: Epigenetics and Editing the Epigenome

    Type
    Blog Post
    Updated
    June 25, 2020, 11:45 a.m.
    ...Transcriptional repression DNA Methyltransferase 3 Alpha (DNMT3A) Vlatka Zoldoš’ lab has deposited pdCas9...Co-expression markers EGFP and PuroR enable sorting and selection of transduced cells....-DNMT3A-EGFP and pdCas9-DNMT3A-PuroR for targeted cytosine methylation in mammalian cells....DNA Methyltransferase MQ1 Margaret Goodell's lab has deposited pcDNA3.1-dCas9-MQ1(Q147L)-EGFP, a fusion...over a period of several days, as seen with other epigenome-editing tools. pLV hUbC-dCas9-MQ1(Q147L)-EGFP...
  12. Cell Migration Consortium Plasmids

    Type
    Collection
    ...Hynes 14098pMA4.1 (mouse integrin alpha 4 probe)Mouse Alpha 4 Integrin (Mus musculus)Bacterial...Expression, RetroviralpBabe-TetCMV-puro Hahn 22032pBabe-TetCMV-puro-mPA-GFP-PA-Rac1mPA-GFP-PA-Rac1...5 probe)Mouse Alpha 5 Integrin (Mus musculus)Bacterial ExpressionpBluescript II SK+...Bacterial ExpressionPBluescript II SK- Hynes 14097pMA5.1 (mouse integrin alpha...Bacterial ExpressionpCR-Script SK+ Hynes 14071Comp AlphaPS3Drosphila Comp Alpha...Bacterial ExpressionPBluescript II SK- Hynes 14070Alt AlphaPS3Drosphila Alt Alpha...sapiens)Mammalian Expression, RetroviralpMX-uGFPGFP Brugge 14567pMX GFP...5 integrin-GFPalpha 5 integrin (Homo sapiens)Mammalian ExpressionpEGFP-N3EGFP Horwitz...14071Comp AlphaPS3Drosphila Comp Alpha PS3 Integrin (Drosophila melanogaster)Bacterial...14098pMA4.1 (mouse integrin alpha 4 probe)Mouse Alpha 4 Integrin (Mus musculus)Bacterial...(Drosophila melanogaster)Insect ExpressionpMT-WGGFP Vale 24288pAc-mCh-TubAlpha-Tubulin...ExpressionPBluescript II SK- Hynes 14097pMA5.1 (mouse integrin alpha...Alt Alpha PS3 Integrin (Drosophila melanogaster)Bacterial ExpressionpCR-Script SK+ Hynes...5 probe)Mouse Alpha 5 Integrin (Mus musculus)Bacterial ExpressionpBluescript II SK+ Hynes...
  13. Zebrafish Plasmid Collection

    Type
    Collection
    ...Mosimann 69542pmtb-t7-alpha-bungarotoxinFor in vitro transcription of alpha-bungarotoxin...Grunwald 74593pKHR5an alpha-crystallin::Venus (green lens) reporter cassette flanked by...Cas9 and GFP are separated by the sequence of a T2A self-cleaving peptide.Cas9-T2A-GFP (Danio rerio)...Genbank accession number is KU144823.FRT-alpha-crystallin::Venus-FRT-loxP reporter cassette (Danio rerio...Genbank accession number is KU144825.FRT-alpha-crystallin::Venus-FRT-loxP reporter cassette (Danio rerio...vector to create transgenes for phiC31-mediated transgenesis in zebrafish, contains an attB site and alpha-cystallin...Ahituv 37846E1b-GFP-Tol2-Gateway Ahituv...mRNA that can be injected into embryos.alpha-bungarotoxin (Synthetic) Megason...-GFP1-9Expresses GFP1-9 in zebrafishGFP1-9 (Synthetic) Shu 125690pT2-5xERE...
  14. Validated gRNA Sequences

    Type
    Collection
    ...26816379 Shaw AMPK alpha 2 H. sapiens GAAGATCGGACACTACGTGC 74377 nick S. pyogenes 26816379 Shaw...74375 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes...pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737 Moffat AMPK alpha...1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens GAAGATCGGCCACTACATTC...S. pyogenes 25619936 Sato gfap D. rerio GTGCGCAACACATAGCACCA 65566 cut S. pyogenes 25849248 Du GFP...Sato IL1RN H. sapiens TGGTGTACTCTCTGAGGTGCTC 64140 activate S. pyogenes 25619936 Sato inverted GFP...26018130 Xue inverted GFP A. victoria GTTGATCCATAACTTCGTAT 66584 cut S. pyogenes 26018130 Xue IRF1...Zhang EGFP A. victoria GATGCCGTTCTTCTGCTTGT 47512 cut S. pyogenes 23792628 Joung EGFP A. victoria...Zhang EGFP A. victoria GGTGGTGCAGATGAACTTCA 47513 cut S. pyogenes 23792628 Joung EGFP A. victoria...Del Bene EGFP A. victoria GGGCACGGGCAGCTTGCCGG 46760 cut S. pyogenes 23918387 Chen EGFP A. victoria...
  15. Plasmid Tools for Microbiome Studies

    Type
    Blog Post
    Updated
    Jan. 6, 2020, 4:12 p.m.
    ...also contain the RP4 transfer origin as well as a selectable marker and a desired genetic payload (ex: GFP...from the microbial community) reveals the RBS and allows translation of the reporter gene resulting in GFP...The plasmids could also be transformed into Alphaproteobacteira, Betaproteobacteria, and Gammaproteobacteria...
  16. Worm Expression Resources

    Type
    Collection
    ...EYFPGluCl alpha (Caenorhabditis elegans) Lester 15105optGluCl beta Y182F...promoter (Caenorhabditis elegans) Ward 62599pKPY197Thr412Gly-CePheRS Alpha...Gouaux 31488pFB-GluCl_crystC. elegans glutamate-gated chloride channel alpha...Jorgensen 31487pGEM-GluCl_crystC. elegans glutamate-gated chloride channel alpha...14107pET_Unc653_GFP_HisUnc104 (1-653) (Caenorhabditis elegans) Vale 15104optGluCl alpha...71364pGC629daf-16 (Caenorhabditis elegans) Hubbard 72673pKPY737Thr412Gly-CePheRS Alpha...-mex3Pmex-5:GFP::H2B::PEST::mex-3 3'UTR reporter construct used for microinjectionPmex-5:GFP::H2B::PEST..._GFP_HisUnc104 (1-653) (Caenorhabditis elegans) Vale 15104optGluCl alpha...-240 (Caenorhabditis elegans) Bartel 47387pcDNA3.1 V5 His-TOPO-GluCl optalpha-mYFP...
  17. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...)-CRY2PHR-NLS-VP64_2A_GFP_WPRE_bGHpANLS(alpha-imp)-CRY2PHR-NLS-VP64 (Synthetic)Mammalian Expression,...Callaway pAAV-hPDGFRA-GFPhuman platelet derived growth factor receptor alpha...Expression, AAVpAAV Callaway pAAV-hST3GAL6-RFPhuman type 2 lactosamine alpha...sapiens), CRY2 (Arabidopsis thaliana), EGFP (Other)Mammalian Expression, AAVpAAV_EF1a_WPRE_hGHpANLS(alpha-imp...Yasuda pAAV-HDR-mEGFP-camk2acalcium/calmodulin-dependent protein kinase II alpha...Expression, AAV ; Adeno-associated viruspAAV Callaway pAAV-mCAMK-RFPmouse alpha-calcium...alpha -miR26a GFP p(A)Mammalian Expression, AAV ; scpEMBLGFP Mendell...platelet derived growth factor receptor alpha polypeptide promoter driving GFP (Homo sapiens)Mammalian...)-CRY2PHR-NLS-VP64_2A_GFP_WPRE_bGHpANLS(alpha-imp)-CRY2PHR-NLS-VP64 (Synthetic)Mammalian Expression,...Synthetic)Mammalian Expression, AAVAAV-ChR2-mCherry Sabatini AAV-FLEX-PKIalpha-IRES-nls-mRuby2PKIalpha...), CRY2 (Arabidopsis thaliana), EGFP (Other)Mammalian Expression, AAVpAAV_EF1a_WPRE_hGHpANLS(alpha-imp...(alpha-imp), NLS-VP64, 2A Irudayaraj DNMT3ACD-CRY2-EGFPDNMT3A (Homo sapiens...
  18. Luciferase Plasmids

    Type
    Collection
    ...Spiegelman 8889PGC-1 alpha promoter luciferase delta MEFPGC-1 alpha promoter dMEF (Mus...8888PGC-1 alpha promoter luciferase delta CREPGC-1 alpha promoter dCRE (Mus musculus)...Wilson 22522 phGluc Gaussia EF1α Expression of Gaussia luciferase; GFP is expressed if cells are...Gambhir 105533 pAAV.CMV.Luc.IRES.EGFP.SV40 Firefly CMV AAV expression of firefly luciferase and GFP...11323pRL-TK 4x mut GFP2 bulged binding sites for CXCR4 siRNA antisense, flanking 2 binding sites for GFP...Bruchez 105538 pENN.AAV.TBG.PI.ffLuciferase.RBG Firefly TGB AAV expression of firefly luciferase and GFP...promoter 2kb luciferasePGC-1 alpha promoter (Mus musculus) Spiegelman...Merlino 71394pFUGW-Pol2-ffLuc2-eGFPLentiviral vector of luciferase-eGFP fusion gene driven...vector of luciferase-eGFP fusion gene driven by FerH promoterFerH-ffLuc2-eGFP (Mus musculus)...140977pcDNA5/FRT/TO-GAlphaoB-RLuc8Encodes a G alpha subunit (GNAO1 Isoform Alpha 2) containing...140975pcDNA5/FRT/TO-GAlphai3-RLuc8Encodes a G alpha subunit (GNAI3) containing RLuc8...140980pcDNA5/FRT/TO-GAlphasS-RLuc8Encodes a G alpha subunit (GNAS2) containing RLuc8 as an optimal...
Showing: 1 - 20 of 55 results