Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Showing: 1 - 4 of 4 results
  1. Sequencing Primers

    Type
    Guide
    ...GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...TACTATTGCCAGCATTGCTGC (Invitrogen) Alpha factor signal sequence, forward primer...beta-globin 3'UTR, reverse primer XEF1a TTTCGCCCTAACTTCGTGAT Xenopus EF1 alpha...ACACAAAGCCGCTCCATCAG (Invitrogen) Drosophila Actin 5C promoter, forward primer Alpha-factor...(Ahmad lab) 5' end of GFP, reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG...terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP...AATACCACTACAATGGAT (BD Biosciences) 3' end of Gal4 activation domain, forward primer GFP-F...CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N...TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F...GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP vs EYFP...
  2. Chemogenetics Guide

    Type
    Guide
    ...Serotype-dependent spreading profiles of AAV-mediated GFP expression in the marmoset cerebral cortex...spread using CMV, CaMKII, and SynI promoter-driven GFP expression *significantly different from AAV1...5 1.3 ± 0.3 8 No statistical difference observed between AAV1, 5, 8, 9 9 1.2 ± 0.4 1Mean of GFP...Different alpha subunits can also have similar phenotypic outcomes....There have been 5 beta-subunits, 11 gamma-subunits, and 20 alpha-subunits identified in mammals....In the resting state, the heterotrimeric G protein is bound to the GPCR and, in particular, the alpha...For example, the alpha subunit αs (Gαs) activates adenylate cyclase, causing production of the common...
  3. CRISPR Guide

    Type
    Guide
    ...GFP) or selection marker to identify and enrich positive cells Packaging and envelope plasmids provide...Genomic Loci Using Fluorophores Using catalytically inactive dCas9 fused to a fluorescent marker like GFP...GFP) to identify and enrich positive cells, or selection marker to generate stable cell lines (for details...System Application Mammalian expression vector Cas enzyme promoter can be constitutive (CMV, EF1alpha...
  4. Molecular Biology Reference

    Type
    Guide
    ...These plasmids contain a reporter gene (for example, luciferase or GFP) that offers a read-out of the...K-12 has led to the common lab strains MG1655 and its derivatives DH5alpha and DH10b (also known as TOP10...recA) mcrB mrr hsdS20 (rB- mB-) supE44 ara14 galK2 lacY1 proA2 rpsL20(StrR) xyl5 lambda- leu mtl1 DH5alpha...
Showing: 1 - 4 of 4 results