Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Showing: 1 - 20 of 38 results
  1. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...Actin Filaments utrophin (aa# 1-261) GFP Bement pIRESneo-EGFP-alpha Tubulin Microtubules alpha-tubulin...mCherry* Davidson pDEST/N1-hEB1-GFP Microtubules EB1 GFP Shaw pmiRFP703-Tubulin Microtubules alpha-tubulin...EGFP Wadsworth pmTurquoise2-Tubulin Microtubules alpha-tubulin mTurquoise2 Gadella mCh-alpha-tubulin...Microtubules alpha-tubulin mCherry Voeltz pPAmCherry-b-actin Actin Filaments beta-actin PAmCherry1...Early endosomes Rab5B AcGFP Voeltz GFP-Rab4B Early endosomes Rab4B AcGFP Voeltz GFP-rab7 WT Late...Rab7a mCherry Voeltz GFP-Rab7A Late endosomes Rab7a AcGFP Voeltz GFP-rab11 WT Recycling endosomes...GFP Takemaru pLenti-EGFP-hChibby1 Mother Centrioles / Ciliary Base Chibby1 EGFP Takemaru GFP-hCCDC11...utrophin (aa# 1-261) GFP Bement pIRESneo-EGFP-alpha Tubulin Microtubules alpha-tubulin EGFP Wadsworth...alpha-tubulin PAmCherry Verkhusha EMTB-3XGFP Microtubules ensconsin GFP Bement EMTB-mCherry Microtubules...Microtubules alpha-tubulin mScarlet-I Gadella pmScarlet-H_alphaTubulin_C1 Microtubules alpha-tubulin...pmTurquoise2-Tubulin Microtubules alpha-tubulin mTurquoise2 Gadella mCh-alpha-tubulin Microtubules...mScarlet-H Gadella pmScarlet_alphaTubulin_C1 Microtubules alpha-tubulin mScarlet Gadella pLenti-EB1...alpha-tubulin mCherry Voeltz pPAmCherry-b-actin Actin Filaments beta-actin PAmCherry1 Verkhusha...
  2. Cre-lox system

    Type
    Collection
    ...dependent on GFP (CRE-DOG) EF-1 alpha AAV Cepko 69572 pCAG-N-CretrcintG Cre recombinase dependent...recombinase dependent on GFP (CRE-DOG) EF-1 alpha AAV Cepko 69571 pAAV-EF1a-C-CreintG Cre recombinase...Sauer 11920 pBS500 EF1alpha-GFPcre Cre-GFP fusion EF-1 alpha Mammalian Sauer 11923 pBS598 EF1alpha-EGFPcre...Cre-EGFP fusion EF-1 alpha Mammalian Sauer 11955 pBS505 EF1alpha-EGFPcre* Cre-EGFP fusion EF-1 alpha...1 alpha AAV Deisseroth 55638 pAAV-EF1a-vCre VCre EF-1 alpha AAV Deisseroth 59701 pRetroQ-Cre-ERT2...Cre and GFP coexpression CAG Retroviral Gage 49054 CAG-GFP/cre Cre-GFP fusion CAG Retroviral Gage...GFP and Cre CAG Mammalian Lu 117148 Hiv7CMV-Cremyc-2A-GFP GFP and Cre CMV Lentiviral Lu 118029...11923 pBS598 EF1alpha-EGFPcre Cre-EGFP fusion EF-1 alpha Mammalian Sauer 11955 pBS505 EF1alpha-EGFPcre.../promoter Mammalian Sauer 11920 pBS500 EF1alpha-GFPcre Cre-GFP fusion EF-1 alpha Mammalian Sauer...* Cre-EGFP fusion EF-1 alpha Mammalian Sauer 11956 pBS594 promoterless EGFPcre Cre-EGFP fusion in...Cre EF-1 alpha Mammalian Sauer 11919 pBS448 RSV-GFPcre Cre-GFP fusion Rous sarcoma virus (RSV) LTR...on GFP (CRE-DOG) EF-1 alpha AAV Cepko 69572 pCAG-N-CretrcintG Cre recombinase dependent on GFP (CRE-DOG...dependent on GFP (CRE-DOG) EF-1 alpha AAV Cepko 69571 pAAV-EF1a-C-CreintG Cre recombinase dependent...
  3. Michael Davidson Fluorescent Protein Collection

    Type
    Collection
    ..., Emission: 610mCherry-Alpha-Actin2-C-18 Data Supplement mCherry-Alpha-Actinin2-N-18Localization: Alpha...-Alpha-Actinin-C-14Localization: Alpha Actinin, Excitation: 505 / 569, Emission: 516 / 581mEos2-Alpha-Actinin-C.../Membrane, Excitation: 400 / 504, Emission: 515 / 517mPA-GFP-CD151-7 Data Supplement mPA-GFP-C-Src-...: 400 / 504, Emission: 515 / 517mPA-GFP-EB3-7 Data Supplement mPA-GFP-ER-3Localization: Endoplasmic...: 400 / 504, Emission: 515 / 517mPA-GFP-MannII-N-10 Data Supplement mPA-GFP-MAP4-C-10Localization:...mPA-GFP-MCHR1-N-10Localization: Cilium, Excitation: 400 / 504, Emission: 515 / 517mPA-GFP-MCHR1-N-.../ 504, Emission: 515 / 517mPA-GFP-MyosinIIA-C-18 Data Supplement mPA-GFP-Paxillin-22Localization:...-19Localization: Non-muscle Alpha Actinin, Excitation: 485, Emission: 507sfGFP-Alpha-Actinin-19 Data...507EGFP-Alpha-5-Integrin-10 Data Supplement EGFP-ER-14Localization: Endoplasmic Reticulum, Excitation...7 Data Supplement EGFP-Alpha-5-Integrin-10Localization: Focal Adhesions, Excitation: 488, Emission:...580, Emission: 515 mKind2-PDHA1-N-10Localization: Mitochondria, Excitation: 580, Emission: 515 EGFP-BaxAlpha-C...20Localization: Lysosome Membrane, Excitation: 487, Emission: 509Emerald-Lysosomes-20 Data Supplement sfGFP-Alpha-Actinin...: 516 / 581tdEos-Alpha-Actinin-19 Data Supplement tdEos-Alpha-Actinin2-N-18Localization: Alpha Actinin...
  4. Cell Migration Consortium Plasmids

    Type
    Collection
    ...Hynes 14098pMA4.1 (mouse integrin alpha 4 probe)Mouse Alpha 4 Integrin (Mus musculus)Bacterial...Expression, RetroviralpBabe-TetCMV-puro Hahn 22032pBabe-TetCMV-puro-mPA-GFP-PA-Rac1mPA-GFP-PA-Rac1...5 probe)Mouse Alpha 5 Integrin (Mus musculus)Bacterial ExpressionpBluescript II SK+...Bacterial ExpressionPBluescript II SK- Hynes 14097pMA5.1 (mouse integrin alpha...Bacterial ExpressionpCR-Script SK+ Hynes 14071Comp AlphaPS3Drosphila Comp Alpha...Bacterial ExpressionPBluescript II SK- Hynes 14070Alt AlphaPS3Drosphila Alt Alpha...sapiens)Mammalian Expression, RetroviralpMX-uGFPGFP Brugge 14567pMX GFP...5 integrin-GFPalpha 5 integrin (Homo sapiens)Mammalian ExpressionpEGFP-N3EGFP Horwitz...14071Comp AlphaPS3Drosphila Comp Alpha PS3 Integrin (Drosophila melanogaster)Bacterial...14098pMA4.1 (mouse integrin alpha 4 probe)Mouse Alpha 4 Integrin (Mus musculus)Bacterial...(Drosophila melanogaster)Insect ExpressionpMT-WGGFP Vale 24288pAc-mCh-TubAlpha-Tubulin...ExpressionPBluescript II SK- Hynes 14097pMA5.1 (mouse integrin alpha...Alt Alpha PS3 Integrin (Drosophila melanogaster)Bacterial ExpressionpCR-Script SK+ Hynes...5 probe)Mouse Alpha 5 Integrin (Mus musculus)Bacterial ExpressionpBluescript II SK+ Hynes...
  5. Zebrafish Plasmid Collection

    Type
    Collection
    ...Mosimann 69542pmtb-t7-alpha-bungarotoxinFor in vitro transcription of alpha-bungarotoxin...Grunwald 74593pKHR5an alpha-crystallin::Venus (green lens) reporter cassette flanked by...Cas9 and GFP are separated by the sequence of a T2A self-cleaving peptide.Cas9-T2A-GFP (Danio rerio)...Genbank accession number is KU144823.FRT-alpha-crystallin::Venus-FRT-loxP reporter cassette (Danio rerio...Genbank accession number is KU144825.FRT-alpha-crystallin::Venus-FRT-loxP reporter cassette (Danio rerio...vector to create transgenes for phiC31-mediated transgenesis in zebrafish, contains an attB site and alpha-cystallin...Ahituv 37846E1b-GFP-Tol2-Gateway Ahituv...mRNA that can be injected into embryos.alpha-bungarotoxin (Synthetic) Megason...-GFP1-9Expresses GFP1-9 in zebrafishGFP1-9 (Synthetic) Shu 125690pT2-5xERE...
  6. Validated gRNA Sequences

    Type
    Collection
    ...26816379 Shaw AMPK alpha 2 H. sapiens GAAGATCGGACACTACGTGC 74377 nick S. pyogenes 26816379 Shaw...74375 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes...pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737 Moffat AMPK alpha...1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens GAAGATCGGCCACTACATTC...S. pyogenes 25619936 Sato gfap D. rerio GTGCGCAACACATAGCACCA 65566 cut S. pyogenes 25849248 Du GFP...Sato IL1RN H. sapiens TGGTGTACTCTCTGAGGTGCTC 64140 activate S. pyogenes 25619936 Sato inverted GFP...26018130 Xue inverted GFP A. victoria GTTGATCCATAACTTCGTAT 66584 cut S. pyogenes 26018130 Xue IRF1...Zhang EGFP A. victoria GATGCCGTTCTTCTGCTTGT 47512 cut S. pyogenes 23792628 Joung EGFP A. victoria...Zhang EGFP A. victoria GGTGGTGCAGATGAACTTCA 47513 cut S. pyogenes 23792628 Joung EGFP A. victoria...Del Bene EGFP A. victoria GGGCACGGGCAGCTTGCCGG 46760 cut S. pyogenes 23918387 Chen EGFP A. victoria...
  7. Worm Expression Resources

    Type
    Collection
    ...EYFPGluCl alpha (Caenorhabditis elegans) Lester 15105optGluCl beta Y182F...promoter (Caenorhabditis elegans) Ward 62599pKPY197Thr412Gly-CePheRS Alpha...Gouaux 31488pFB-GluCl_crystC. elegans glutamate-gated chloride channel alpha...Jorgensen 31487pGEM-GluCl_crystC. elegans glutamate-gated chloride channel alpha...14107pET_Unc653_GFP_HisUnc104 (1-653) (Caenorhabditis elegans) Vale 15104optGluCl alpha...71364pGC629daf-16 (Caenorhabditis elegans) Hubbard 72673pKPY737Thr412Gly-CePheRS Alpha...-mex3Pmex-5:GFP::H2B::PEST::mex-3 3'UTR reporter construct used for microinjectionPmex-5:GFP::H2B::PEST..._GFP_HisUnc104 (1-653) (Caenorhabditis elegans) Vale 15104optGluCl alpha...-240 (Caenorhabditis elegans) Bartel 47387pcDNA3.1 V5 His-TOPO-GluCl optalpha-mYFP...
  8. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...)-CRY2PHR-NLS-VP64_2A_GFP_WPRE_bGHpANLS(alpha-imp)-CRY2PHR-NLS-VP64 (Synthetic)Mammalian Expression,...Callaway pAAV-hPDGFRA-GFPhuman platelet derived growth factor receptor alpha...Expression, AAVpAAV Callaway pAAV-hST3GAL6-RFPhuman type 2 lactosamine alpha...sapiens), CRY2 (Arabidopsis thaliana), EGFP (Other)Mammalian Expression, AAVpAAV_EF1a_WPRE_hGHpANLS(alpha-imp...Yasuda pAAV-HDR-mEGFP-camk2acalcium/calmodulin-dependent protein kinase II alpha...Expression, AAV ; Adeno-associated viruspAAV Callaway pAAV-mCAMK-RFPmouse alpha-calcium...alpha -miR26a GFP p(A)Mammalian Expression, AAV ; scpEMBLGFP Mendell...platelet derived growth factor receptor alpha polypeptide promoter driving GFP (Homo sapiens)Mammalian...)-CRY2PHR-NLS-VP64_2A_GFP_WPRE_bGHpANLS(alpha-imp)-CRY2PHR-NLS-VP64 (Synthetic)Mammalian Expression,...Synthetic)Mammalian Expression, AAVAAV-ChR2-mCherry Sabatini AAV-FLEX-PKIalpha-IRES-nls-mRuby2PKIalpha...), CRY2 (Arabidopsis thaliana), EGFP (Other)Mammalian Expression, AAVpAAV_EF1a_WPRE_hGHpANLS(alpha-imp...(alpha-imp), NLS-VP64, 2A Irudayaraj DNMT3ACD-CRY2-EGFPDNMT3A (Homo sapiens...
  9. Luciferase Plasmids

    Type
    Collection
    ...Spiegelman 8889PGC-1 alpha promoter luciferase delta MEFPGC-1 alpha promoter dMEF (Mus...8888PGC-1 alpha promoter luciferase delta CREPGC-1 alpha promoter dCRE (Mus musculus)...Wilson 22522 phGluc Gaussia EF1α Expression of Gaussia luciferase; GFP is expressed if cells are...Gambhir 105533 pAAV.CMV.Luc.IRES.EGFP.SV40 Firefly CMV AAV expression of firefly luciferase and GFP...11323pRL-TK 4x mut GFP2 bulged binding sites for CXCR4 siRNA antisense, flanking 2 binding sites for GFP...Bruchez 105538 pENN.AAV.TBG.PI.ffLuciferase.RBG Firefly TGB AAV expression of firefly luciferase and GFP...promoter 2kb luciferasePGC-1 alpha promoter (Mus musculus) Spiegelman...Merlino 71394pFUGW-Pol2-ffLuc2-eGFPLentiviral vector of luciferase-eGFP fusion gene driven...vector of luciferase-eGFP fusion gene driven by FerH promoterFerH-ffLuc2-eGFP (Mus musculus)...140977pcDNA5/FRT/TO-GAlphaoB-RLuc8Encodes a G alpha subunit (GNAO1 Isoform Alpha 2) containing...140975pcDNA5/FRT/TO-GAlphai3-RLuc8Encodes a G alpha subunit (GNAI3) containing RLuc8...140980pcDNA5/FRT/TO-GAlphasS-RLuc8Encodes a G alpha subunit (GNAS2) containing RLuc8 as an optimal...
  10. Plasmids for Optogenetics Research

    Type
    Collection
    ..._pAAV_hSyn_CRY2PHR-NLS-SID4X_2A_phiLOV2.1_WPRE_bGHpA LITE AAV Zhang 47455 LITE2.0 pAAV_hSyn_NLS(alpha-imp...(NLS*,∆318-334)_WPRE_bGHpA LITE AAV Zhang 47457 LITE2.0 EF1a_NLS(alpha-imp)-CRY2PHR-NLS-VP64_2A_GFP_WPRE_hGHpA...pAAV-Syn-FLEX-Mac-GFP Inhibitory Mac AAV GFP Boyden 58853 pAAV-Syn-Mac-GFP Inhibitory Mac AAV GFP...Inhibitory Mac AAV GFP Boyden 58841 pAAV-Syn-CsChR-GFP Excitatory CsChR AAV GFP Boyden 58849 pAAV-CaMKII-Mac-GFP...Arch AAV GFP Boyden 26929 AAV-CAG-ChR2-GFP Excitatory ChR2 AAV GFP Boyden 26966 pAAV-Ef1a-DIO...Inhibitory ArchT AAV GFP Boyden 29777 pAAV-CAG-ArchT-GFP  Inhibitory ArchT AAV GFP Boyden 29778...Excitatory Chronos AAV GFP Boyden 58806 pAAV-Syn-ChrimsonR-GFP Excitatory ChrimsonR AAV GFP Boyden...  Excitatory CoChR AAV EGFP Boyden 107709 pAAV-EF1alpha-soCoChR-GFP Excitatory CoChR AAV EGFP Boyden...47457 LITE2.0 EF1a_NLS(alpha-imp)-CRY2PHR-NLS-VP64_2A_GFP_WPRE_hGHpA LITE Mammalian GFP Zhang 47458...LITE AAV Zhang 47455 LITE2.0 pAAV_hSyn_NLS(alpha-imp)-CRY2PHR-NLS-VP64_2A_GFP_WPRE_bGHpA LITE AAV...107713 pAAV-hSyn-soCoChR-mCardinal Excitatory CoChR AAV mCardinal Boyden 107714 pAAV-EF1alpha-soCoChR-tdTomato...-GFP Excitatory ChR2 AAV GFP Boyden 59325 pRVdG-4ArchT-EGFP Inhibitory ArchT Rabies Virus GFP Wickersham...GFP Boyden 58841 pAAV-Syn-CsChR-GFP Excitatory CsChR AAV GFP Boyden 58849 pAAV-CaMKII-Mac-GFP Inhibitory...CIBN-GFP-TMD Cry2-CIB1 Mammalian EGFP De_Camilli 79572 Lyn11-CIBN-GFP Cry2-CIB1 Mammalian EGFP De_Camilli...
  11. Lentivirus Plasmids

    Type
    Collection
    ...See plasmid 17618 for GFP plasmid....Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP as a...FUGW 3rd hUbC-driven EGFP; can be used for cDNA expression Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP...Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-expression....Trono 12254 pWPI 2nd EF-1alpha driven constitutive transgene expression and EGFP coexpression....Nolan 12257 pWPXL 2nd EF-1alpha driven constitutive transgene expression, contains intron that gives...Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion; can be used for cDNA expression; puro resistance...Moore 19319 pLJM1-EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895 pLX301 3rd Gateway...
  12. Chemogenetics Plasmids

    Type
    Collection
    ...is Gs alpha with the C-terminal amino acids changed from Gs alpha to Gq alpha residues This construct...amino acids of Gq alpha with those of Gz alpha Works the same as qi5 Conklin 24499 sq5 Gs alpha This...ID Name Gene Mutation Depositor Comments PI 24502 q4wt Gq alpha none This is Gq alpha with an HA...allows some Gs-coupled receptors to stimulate phospholipase C Conklin 24501 qi5 Gq alpha Gq alpha...with the C-terminal amino acids changed from Gq alpha to Gi alpha residues This construct allows many...amino acids changed from Gq alpha to Go alpha residues Works the same as qi5 but (for unknown reasons...Replacement of the five carboxyl-terminal amino acids of Gq alpha with those of Gs alpha This construct...  Syn1 none AAV, Non-cre EGFP expression control Roth 50457 pAAV-hSyn-DIO-EGFP  Syn1 none AAV, Cre...EGFP expression control Roth 50474 pAAV-hSyn-hM3D(Gq)-mCherry  Syn1 hM3D(Gq) AAV, Non-cre Neuronal...  CaMKIIa none AAV, Non-cre EGFP expression control Roth 50476 pAAV-CaMKIIa-hM3D(Gq)-mCherry  CaMKIIa...Clear Filters ID Name Promoter Receptor Plasmid Type Activity PI 50469 pAAV-CaMKIIa-EGFP...50458 pAAV-hSyn-DIO-rM3D(Gs)-mCherry Syn1 hM3D(Gs) AAV, Cre cAMP production Roth 50465 pAAV-hSyn-EGFP...
  13. Antibodies

    Type
    Collection
    ...J1 antibody)Brg1 (Homo sapiens) Crabtree 26759pNinaZScFv-BsaAIinaZ, (alpha...clone) 4EA1 against all mouse interferon α subtypes in mammalian cellsantibody against mouse interferon alpha...(MoonTag-Nb-GFP)Expresses nanobody-2H10 fused to super folded GFP (sfGFP) in mammalian cells....CRY2 PHR E490G fused to anti-GFP nanobody for optogeneticsCRY2 PHRolig-VHH(GFP) (Arabidopsis thaliana...)express RFP-tagged CRY2 PHR domain fused to anti-GFP nanobody for optogeneticsCRY2 PHR-VHH(GFP) (Arabidopsis...expression of a fusion protein consisting of a GFP nanobody (Dr....nanobody and ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins....(Human) recombinant mouse monoclonal antibodyanti-GABA(A)R, Alpha5 (Homo sapiens) recombinant mouse...maxi-K+ channel (Mouse) recombinant mouse monocolonal antibodyanti-Slo1/BKAlpha maxi-K+ channel (Mouse...musculus) Trimmer 149456N415/24RMammalian Expression of anti-GABA(A)R, Alpha5...antibody (Mus musculus) Trimmer 128634L6/23RMammalian Expression of Slo1/BKAlpha...(MoonTag-Nb-GFP)Expresses nanobody-2H10 fused to super folded GFP (sfGFP) in mammalian cells....
  14. CRISPR Plasmids - Repress Gene Expression

    Type
    Collection
    ...Transient expression of Sp-dCas9 in mammalian cells, under an EF1-alpha promoter....Multiplex Enhancer Interference Reveals Collaborative Control of Gene Regulation by Estrogen Receptor alpha-Bound...pEF_dCas9dCas9 (Other)human EF1[alpha...EBNA episome plasmid for CAG promoter constitutive expression of dCas9-GFP....Co-expresses human optimized S. pyogenes dCas9 and GFP FUGW...Co-expressed human optimized S. pyogenese dCas9 fused to KRAB repressor domain and GFP FUGW...TRE-KRAB-dCas9-IRES-GFPKRAB-dCas9-IRES-GFP...-IRES-GFP (Synthetic)TRE3GGFP Lander Systematic mapping of functional enhancer-promoter...Human expression vector containing Ubiquitous Chromatin Opening Element (UCOE) upstream of EF1alpha promoter...pEF1a-CRY2PHR-SID4XSID4X-CYR2PHR (Synthetic)EF1alpha...Tag / Fusion ProteinHA-TagBFP-KRAB-NLS (C terminal on insert) pCXLE-dCas9GFP-shP53dCas9GFP-shP53...inactivated catalytic domains Cas9 protein plant expression driven by the 35S promoter pDGB3alpha2...of (human codon optimized) inactivated Cas9 fused to the BRD Transcriptional Repressor pDGB3alpha2...
  15. Plasmids for Stem Cell Research

    Type
    Collection
    ...pSN25mCitrine-P2A-SOX2 fused to full length HP1 alpha (Homo sapiens)Mammalian Expression, Lentiviral...pSN29mCerulean-P2A-cMYC fused to full length HP1 alpha (Homo sapiens)Mammalian Expression, Lentiviral...pSN17vexGFP-P2A-OCT4 fused to full length HP1 alpha (Homo sapiens)Mammalian Expression, Lentiviral...pSN33mCherry-P2A-KLF4 fused to full length HP1 alpha (Homo sapiens)Mammalian Expression, Lentiviral...OCT4-GFP-2A-PURO transgenic reporterGFP-2A-puro (Synthetic), OCT4 (Homo sapiens)Mammalian Expression...pCAG-SpCas9-GFP-U6-gRNASpCas9Mammalian Expression, CRISPR Zou The ribosomal...pCW57-GFP-miR-302clusterhuman miR-302 cluster: MIR302B, MIR302C, MIR302A, MIR302D, MIR367 (Homo sapiens...pSN17vexGFP-P2A-OCT4 fused to full length HP1 alpha (Homo sapiens)Mammalian Expression, Lentiviral...Oct4-ires-EGFP(lox neo)EGFP, Oct4 (Mus musculus)Mouse Targeting Jaenisch...OCT4-GFP-2A-PURO transgenic reporterGFP-2A-puro (Synthetic), OCT4 (Homo sapiens)Mammalian Expression...OCT4-eGFP-2A-PuroOCT4 (Homo sapiens), eGFPtargeting donor Jaenisch Genetic...
  16. CRISPR Plasmids - Activate Gene Expression

    Type
    Collection
    ...expression of Sp-dCas9 fused to the VP64 transcription activator, in mammalian cells, under an EF1-alpha...pEF_dCas9-VP64dCas9 (Other)human EF1[alpha...pCXLE-dCas9VPH-T2A-GFP-shP53dCas9VPH-T2A-GFP-shP53...pCXLE-dCas9VPPH-T2A-GFP-shP53dCas9VPPH-T2A-GFP-shP53...-p65-HSF1-P300-T2A-GFP-IRES-Neo (Other)TRE-tightNeomycin (select with G418) Otonkoski...-T2A-GFP-shP53 (Other)CAG Otonkoski Human pluripotent reprogramming with...-p65-HSF1-T2A-GFP-IRES-Neo (Other)CAGNeomycin (select with G418) Otonkoski...PB_tre_dCas9_VP160dCas9 fusion with VP160, Hygromycin resistanceTRE, EF1 alphaHygromycin...pHAGE EF1α dCas9-VP64dCas9 (Other)EF1alphaPuromycin..._GFPdCAS9(D10A,H840A)-VP64_2A_GFP (Synthetic)EF1AGFP Zhang Genome-scale transcriptional...-VP192-T2A-EGFP (Other)EGFP Otonkoski...
  17. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...PMP34 Peroxisomes 101785 TUBA1B-mTagRFP-T AICSDP-28 mTagRFP-T Alpha...Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP AICSDP-4 mEGFP Alpha-tubulin...AICSDP-60 mEGFP Transcription factor SOX-2 Transcription Factor 124607 ACTN2-mEGFP AICSDP-63 mEGFP Alpha-actinin...124607 ACTN2-mEGFP AICSDP-63 mEGFP Alpha-actinin-2 Sarcomeric z-disk 124608 NPM1-mTagRFP-T AICSDP...Alpha-tubulin Microtubules 87422 LMNB1-mEGFP AICSDP-10 mEGFP Nuclear...EGFP Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP AICSDP-4 mEGFP...AICSDP-19 mEGFP LAMP-1 Lysosome 101783 MAP1LC3B-mEGFP AICSDP-25 mEGFP LC3...Desmosomes 87425 ACTB-mEGFP AICSDP-15 mEGFP Beta-actin Actin...87427 FBL-mEGFP AICSDP-13 mEGFP Fibrillarin Nucleolus...
  18. Synthetic Biology - Browse Plasmids

    Type
    Collection
    ...pBullet-cg-ndestination vector with cis-golgi marker (alpha-man I 49AA) -ECFP for tagged fluorescent...pBullet-cg-cdestination vector with cis-golgi marker (alpha-man I 49AA) -ECFP for tagged fluorescent...pDGB1_alpha1GoldenBraid level 1 Alpha plant expression vector. empty vector (Other)Plant Expression,...pDGB1_alpha2GoldenBraid level 1 Alpha plant expression vector. empty vector (Other)Plant Expression,...pDGB1_alpha1RGoldenBraid level 1 Alpha plant expression vector. empty vector (Other)Plant Expression,...pDGB1_alpha2RGoldenBraid level 1 Alpha plant expression vector. empty vector (Other)Plant Expression,...pDGB3_alpha1GoldenBraid level 1 Alpha plant expression vector. empty vector (Other)Plant Expression,...palphaGGFPRAlpha-gliadin gene promoter driving GFP expressionalpha-Gliadin promoter (Other)Plant Expression...pDGB1alpha1_SF (GB0106)Twister plasmid to swap inserts from an alpha2 or alpha2R vector to any omega...pDGB1alpha2_SF (GB0107)Twister plasmid to swap inserts from an alpha1 or alpha1R vector to any omega...pDGB1_alpha1GoldenBraid level 1 Alpha plant expression vector. empty vector (Other)Plant Expression,...pDGB1_alpha2GoldenBraid level 1 Alpha plant expression vector. empty vector (Other)Plant Expression,...pDGB1_alpha1RGoldenBraid level 1 Alpha plant expression vector. empty vector (Other)Plant Expression,...pDGB1_alpha2RGoldenBraid level 1 Alpha plant expression vector. empty vector (Other)Plant Expression,...
  19. Synthetic Biology - Networks and Gene Regulation

    Type
    Collection
    ...pEF-H2B-mCherry-T2A-rTetR-EEDH2B-mCherry-T2A-rTetR-EED (Homo sapiens)Mammalian Expression, Synthetic BiologypEF alpha...pEF-H2B-mCherry-T2A-rTetR-KRABH2B-mCherry-T2A-rTetR-KRAB (Homo sapiens)Mammalian Expression, Synthetic BiologypEF alpha...pEF-H2B-mCherry-T2A-rTetR-HDAC4H2B-mCherry-T2A-rTetR-HDAC4 (Homo sapiens)Mammalian Expression, Synthetic BiologypEF alpha...pEF-H2B-mCherry-T2A-rTetR-KRAB-ZeoH2B-mCherry-T2A-rTetR-KRAB (Homo sapiens)Mammalian Expression, Synthetic BiologypEF alpha...pEF-H2B-mCherry-T2A-rTetR-HDAC4-ZeoH2B-mCherry-T2A-rTetR-HDAC4 (Homo sapiens)Mammalian Expression, Synthetic BiologypEF alpha...SS13 lac-inducible GFP reporter circuitGFPBacterial Expression, Synthetic Biology Sauro...pSB4A5 JQ929581mKate2 (Synthetic), Superfolder GFP (Synthetic)Synthetic Biology ; BioBrick cloning vector...pTHSSd_29alpha fragment (Synthetic)Bacterial ExpressionPTac Voigt A 'resource...Lyn-Ceruleanx3-bGHpA (Synthetic), CMV::mCherryx3-linker-betaActin-bGHpA (Synthetic), CMV::Citrinex3-linker-alphaTubulin-bGHpA...
  20. Parkinson's Disease Plasmid Resource

    Type
    Collection
    ...RetroviralpBMN-Z-LacZEYFP Youle pOTTC293 - pAAV EF1a V5-synuclein (WT)alpha-synuclein...(Homo sapiens)CloningGeneric cloning backbone MJFF pET21a-alpha-synucleinalpha-synuclein...P301LTau E14 P301L (Homo sapiens)Mammalian ExpressionpRK5EGFP Ashe human Alpha-synucleinAlpha-synuclein...(Homo sapiens)Mammalian ExpressionpEGFP-C1EGFP Rubinsztein EGFP-alphasynuclein-A53TSNCA...(Homo sapiens)Mammalian ExpressionpEGFP-C1EGFP Rubinsztein pHM6-alphasynuclein-WTSNCA..._BC_1520_2148_K1906MLRRK2 (Homo sapiens)BaculoviruspEMB1086xHis MJFF EGFP-alphasynuclein-WTSNCA...human Alpha-synucleinAlpha-synuclein (Homo sapiens)CloningGeneric cloning backbone...PINK1 C-GFPPINK1 (Homo sapiens)Mammalian ExpressionpcDNA-DEST47GFP Cookson...MJFF pET21a-alpha-synucleinalpha-synuclein (Homo sapiens)Bacterial ExpressionpET21a...(Homo sapiens)Mammalian ExpressionpRK5EGFP Ashe pRK5-EGFP-Tau APTau AP...
Showing: 1 - 20 of 38 results