Skip to main content
Addgene

We narrowed to 10 results for: αGFP

Showing: 1 - 10 of 10 results
  1. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ... Gerlich 25999 LV-GFP Chromatin H2B GFP Elaine Fuchs 11680 H2B-GFP Chromatin H2B GFP Geoff Wahl 21210 ...Microtubules alpha-tubulin mCherry* Michael Davidson 12298 pIRESneo-EGFP-alpha Tubulin Microtubules alpha-tubulin...Beta-catenin GFP Adherens Junctions Beta-catenin EGFP Alpha Yap 67937 mouse E-cadherin GFP (423) Adherens...61803 GFP-Rab7A Late endosomes Rab7a AcGFP Gia Voeltz 12605 GFP-rab7 WT Late endosomes RAB7 GFP Richard...St-Pierre 49149 mCh-alpha-tubulin Microtubules alpha-tubulin mCherry Gia Voeltz 89472 GFP-hChibby1 Mother ...Brown 11908 pEGFP-N1 alpha-actinin 1 Actin Filaments alpha-actinin 1 EGFP Carol Otey 27676 Cortactin-pmCherryC1... Huttenlocher 11908 pEGFP-N1 alpha-actinin 1 Focal Adhesions alpha-actinin 1 EGFP Carol Otey 31923 pPaxillin-PSmOrange...
  2. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...GAL 72Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15583 GAL 103Q+ProGFPp416 HTT GFP GAL1 Huntington's...
  3. Validated gRNA Sequences

    Type
    Collection
    ...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...Moffat AMPK alpha 1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens...Shaw AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...
  4. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...87420 PXN-EGFP AICSDP-1 EGFP Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP AICSDP-4 mEGFP Alpha-tubulin ...AICSDP-28 mTagRFP-T Alpha-tubulin Microtubules 101786 ST6GAL1-mEGFP AICSDP-26 mEGFP Sialyltransferase 1...AICSDP-63 mEGFP Alpha-actinin-2 Sarcomeric z-disks 124608 NPM1-mTagRFP-T AICSDP-69 mTagRFP-T Nucleophosmin...87422 LMNB1-mEGFP AICSDP-10 mEGFP Lamin B1 Nuclear envelope 87423 TOMM20-mEGFP AICSDP-8 mEGFP Tom20 Mitochondria...Mitochondria 87424 DSP-mEGFP AICSDP-9 mEGFP Desmoplakin Desmosomes 87425 ACTB-mEGFP AICSDP-15 mEGFP Beta-actin Actin... SEC61B-mEGFP AICSDP-7 mEGFP Sec61 beta Endoplasmic reticulum 87427 FBL-mEGFP AICSDP-13 mEGFP Fibrillarin...101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP-1 Lysosome 101783 MAP1LC3B-mEGFP AICSDP-25 mEGFP Autophagy-related...
  5. Lentivirus Plasmids

    Type
    Collection
    ...hUbC-driven EGFP; can be used for cDNA expression Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA ...17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP as a reporter....reporter. See plasmid 17618 for GFP plasmid. Cheng 17452 pLenti CMV Puro DEST 3rd Gateway destination plasmid...plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-expression. See plasmid...expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion; can be used for cDNA expression...Trono 12254 pWPI 2nd EF-1alpha driven constitutive transgene expression and EGFP coexpression. Trono 17619...other versions of pULTRA. Moore 19319 pLJM1-EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895...
  6. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...199419 Anti-GFP [N86/38R-2b] GFP Aequorea victoria Mouse IgG2b 199420 Anti-GFP [N86/8R-2b] GFP Aequorea ...206719 Anti-GFP [N86/38R-1] GFP Aequorea victoria Mouse IgG2a 206720 Anti-GFP [N86/8R-1] GFP Aequorea victoria...Rat Mouse 206743 GFP scFv [N86/44] N86/44 scFv GFP Aequorea victoria Mouse 206744 GFP scFv [N86/20] N86...Mouse 199429 GFP scFv [N86/8] N86/8 scFv GFP Aequorea victoria Mouse 199430 GABA(A)R, Alpha1 scFv [N95/35...short and long Rat Mouse IgG2a 114492 Anti-GFP [N86/38.1R] GFP Aequorea victoria Mouse IgG2a 114493 Anti-NGL...glutamate receptor Rat Mouse IgG2a 177572 Anti-GFP [N86/8R] GFP Aequorea victoria Mouse IgG2a 177573 Anti-...N479/107R] VAPA/B Mouse IgG2a 188164 Anti-GFP [N86/44R] GFP Aequorea victoria Mouse IgG2a 188165 Anti-...
  7. Neurodegeneration Research Collection

    Type
    Collection
    ... and Noteworthy: Use a CRISPRi system to target alpha-synuclein. Sastre et al. Sci Rep. 2023 Oct 18. ...Cre-dependent expression of diphtheria toxin receptor (DTR)–GFP fusion protein. Azim et al. Nature. 2014 Apr 17. ...
  8. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...shRNA against mouse TNF-alpha mRNA from the mouse U6 promoter pCDH-EF1-Nluc-P2A-copGFP-T2A-Puro 73022 Expresses... pCDH-EF1-copGFP 73030 Expresses copGFP from the EF1 promoter pCDH-EF1s-Nluc-P2A-copGFP-T2A-Puro 73032...pCDH-EF1s-copGFP 73034 Expressed copGFP from a truncated EF1 promoter pCDH-CMV-Nluc-P2A-copGFp-T2A-Puro...Lentiviral Vector ID Purpose pCDH-EF1-DIO-copGFP 72253 Expresses copGFP under EF-1 promoter when Cre is expressed... N-acethyl-transferase) pCDH-CB-copGFP-T2A-iCre 72256 Expresses copGFP and iCre under from the CB promoter...CB promoter pCDH-CB-FLPe-P2A-copGFP-T2A-Puro 72258 Expresses FLPe, copGFP and the puromycin resistance...tdTomato from the CB promoter pCDH-EF1-Fon-copGFP 72260 Expresses copGFP from the EF1 promoter when FLP is expressed...
  9. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Calcium erGAP3 (GFP-Aequorin Protein) for imaging of Ca+ dynamics in endoplasmic reticulum GFP-Aequorin Protein...and PDE5alpha. ACS Sens. 2017 Jan 27;2(1):46-51. Tetsuya Kitaguchi cGMP (cyclic GMP) FlincG3 (GFP-based...2020 GENIE Project Calcium jGCaMP7 High-performance GFP-based calcium indicators (Constitutive or Cre-dependent...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing... FLAMP Plasmids Jun Chu cGMP (cyclic GMP) FlincG GFP-based cGMP sensor Differential patterning of cGMP... vascular smooth muscle cells revealed by single GFP-linked biosensors. Proc Natl Acad Sci U S A. 2008... C. elegans neurons Using a Robust and Sensitive GFP-Based cGMP Sensor for Real Time Imaging in Intact...
  10. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ... pCAG-SpCas9-GFP-U6-gRNA 79144 Mammalian hU6 yes, cut S. pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA 79145...Cerulean Church LRG (Lenti_sgRNA_EFS_GFP) 65656 Mammalian/Lentiviral LIC none S. pyogenes GFP Vakoc U6>sgRNA...cut Lb Cpf1 Neo Welker AIO-GFP 74119 Mammalian U6x2 yes, nick S. pyogenes EGFP Jackson AIO-mCherry 74120...pyogenes Zhang pL-CRISPR.EFS.GFP 57818 Mammalian/Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO.1-puro...pyogenes Zhang pLKO5.sgRNA.EFS.GFP 57822 Mammalian/Lentiviral BsmBI none S. pyogenes EGFP Ebert pSECC 60820...tagRFP657 Ebert pL-CRISPR.SFFV.GFP 57827 Mammalian/Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO5.sgRNA.EFS.tRFP...pyogenes Chen pdCas9-DNMT3A-EGFP 71666 Mammalian U6 yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR...
Showing: 1 - 10 of 10 results