We narrowed to 1,717 results for: Tyr

#87388

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87389

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87393

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87398

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87400

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87385

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#177166

Expresses mouse DYRK1A tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells. Lysine at position 188 substituted with Arginine.

Vance Lemmon

Slepak et al Cytoskeleton (Hoboken). 2012 Jul;69(7):5

Dec. 3, 2021

Academic Institutions and Nonprofits only

#49499

Expresses HA-tagged ER Y537S mutant in mammalian cells

Sarat Chandarlapaty

Toy et al Nat Genet. 2013 Dec;45(12):1439-45. doi:

Dec. 12, 2013

Academic Institutions and Nonprofits only

#213247

The DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.

Thomas Sakmar

Dahl et al Sci Adv. 2023 May 3;9(18):eadf9297. doi:

April 23, 2024

Academic Institutions and Nonprofits only

#246435

Expresses inactive EGFP (Y67X) in mammalian cells for trans-splicing assessments. LMNA intron is inserted into EGFP CDS.

Ailong Ke

Xu et al Cell. 2025 Aug 18:S0092-8674(25)00854-2.

Oct. 27, 2025

Academic Institutions and Nonprofits only

#159433

expresses Lck-TurboID in mammalian cells

Arthur Salomon

Chua et al J Proteome Res. 2020 Nov 13. doi: 10.102

Nov. 17, 2020

Academic Institutions and Nonprofits only

#231587

ALPK1 gene mutated in position Y254C (Pathogenic mutation in ROSAH syndrome) under control of a doxycycline-inducible promoter

Thomas Henry

Martin et al iScience. 2024 Dec 10;28(1):111563. doi:

Feb. 5, 2025

Academic Institutions and Nonprofits only

#214234

Bacterial expression of the kinase domain of cAbl with a TEV-cleavable N-terminal 6xHis affinity tag; For in vitro tyrosine phosphorylation in peptides/proteins and for kinase specificity screenings

Neel Shah

Shah et al Elife. 2018 Mar 16;7. pii: 35190. doi: 1

Feb. 15, 2024

Academic Institutions and Nonprofits only

#160041

Encodes for MmPyl tRNA synthetase/tRNA pair and for GFP reporter with TAG mutation at site 35, for unnatural amino acid incorporation into the GFP protein in Vibrio natriegens.

Lital Alfonta

Ozer et al Front Bioeng Biotechnol. 2021 Feb 26;9:5

May 11, 2021

Academic Institutions and Nonprofits only

#87405

p426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#205638

reRNA guide targeting HEKsite_1_3

Gerald Schwank

Marquart et al Nat Methods. 2024 Sep 23. doi: 10.1038/s

Sept. 25, 2024

Academic Institutions and Nonprofits only

#65444

Expression of human EPHB4 and GFP in mammalian cells

Eduard Batlle

Cortina et al Nat Genet. 2007 Nov;39(11):1376-83. Epub

Nov. 6, 2015

Academic Institutions and Nonprofits only