We narrowed to 13,416 results for: sequence
-
Plasmid#226489PurposepMOBK360_VM_N2 assembled plasmid (Kanamycin R) containing three inserts (POC1539-POC1541) assembled in POC1519 using the site-selective methylation protection approachDepositorInsertAssembled construct flanked by methylation-protectable BsaI sites and containing several always-methylable internal BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1548
Plasmid#226490PurposepMOBK360_VM_N3 assembled plasmid (Kanamycin R) containing two inserts (POC1542-POC1543) assembled in POC1519 using the site-selective methylation protection approachDepositorInsertAssembled construct flanked by methylation-protectable BsaI sites and containing several always-methylable internal BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1549
Plasmid#226491PurposepMOBK360_VR_N4 assembled plasmid (Kanamycin R) containing two inserts (POC1544-POC1545) assembled in POC1520 using the site-selective methylation protection approachDepositorInsertAssembled construct flanked by methylation-protectable BsaI sites and containing several always-methylable internal BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFLtail
Plasmid#232055PurposeExpresses construct for surface tethering: R. norvegicus NFL tail domainDepositorInsertNeurofilament-Light tail domain
Tags6xHisExpressionBacterialMutationcDNA codon-optimized for E. coli; added N-termina…PromoterT7Available SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFHtail
Plasmid#232057PurposeExpresses construct for surface tethering: R. norvegicus NFH tail domainDepositorInsertNeurofilament-Heavy tail domain
Tags6xHisExpressionBacterialMutationadded N-terminal tryptophan and tyrosine, and cys…Available SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ103-rbs1-m1
Plasmid#204463PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR A127N mutation.DepositorInsertsUseSynthetic BiologyMutationLasR A127N mutationPromoterIn an operon and PLasAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ103-rbs1-m2
Plasmid#204464PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR L128C mutation.DepositorInsertsUseSynthetic BiologyMutationLasR L128C mutationPromoterIn an operon and PLasAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ103-rbs1-m3
Plasmid#204465PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR L125W-A127S mutation.DepositorInsertsUseSynthetic BiologyMutationLasR L125W-A127S mutationPromoterIn an operon and PLasAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ103-rbs1-m4
Plasmid#204466PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR L125W-A127T mutation.DepositorInsertsUseSynthetic BiologyMutationLasR L125W-A127T mutationPromoterIn an operon and PLasAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ103-rbs1-m5
Plasmid#204467PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR L125F-A127G-S129N mutation.DepositorInsertsUseSynthetic BiologyMutationLasR L125F-A127G-S129N mutationPromoterIn an operon and PLasAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ103-rbs1-m6
Plasmid#204468PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR L125W-S129N-L130V mutation.DepositorInsertsUseSynthetic BiologyMutationLasR L125W-S129N-L130V mutationPromoterIn an operon and PLasAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ103-rbs1-m7
Plasmid#204469PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR L125W-A127T-L128M mutation.DepositorInsertsUseSynthetic BiologyMutationLasR L125W-A127T-L128M mutationPromoterIn an operon and PLasAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-2xMS2
Plasmid#212627PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-2xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-12xMS2
Plasmid#212628PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-12xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-4xMS2
Plasmid#212626PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-4xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMAT_CD28ICD
Plasmid#197098PurposeThis plasmid contains the coding sequence for the intracellular domain of CD28. Digest this insert and add it to pHR_pSFFV_scFVCD19_CD8a_CD3zP2AEGFPDepositorInsertThis plasmid contains the coding sequence for the intracellular domain of CD28.
ExpressionMammalianAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGG-GTS-TurboID
Plasmid#209397PurposeTransiently expressing TurboID fused with a Golgi targeting sequence (GTS) in plantaDepositorInsertGTS-3XHA-TurboID
ExpressionPlantMutationTurboID gene sequence C249APromoterCauliflower mosaic virus (CaMV) 35S promoterAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR2_IRdist_scram
Plasmid#162319PurposeP. aeruginosa PA14 CRISPR2 locus, with a scrambled distal Inverted Repeat of the upstream motifDepositorInsertPseudomonas aeruginosa PA14 CRISPR2 locus
ExpressionBacterialMutationThe distal Upstream Motif site is scrambledPromoterpBADAvailable SinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
Plasmid#193050PurposeEncodes guide RNA expression targeting PX740 landing padDepositorInsertGuide RNA
UseCRISPRExpressionWormPromoterU6Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pASPIre4
Plasmid#196656PurposeDerivative of pASPIre3. Contains SpeI restriction site within the CDS of bxb1 to enable diversification of the 5’-UTR and codons 2-16.DepositorInsertBxb1-sfGFP fusion controlled by rhamnose promoter; attB/attP-flanked discriminator; exchangable 5'-UTR and CDS (codons 1-16)
ExpressionBacterialMutationSpeI site in Bxb1 CDSPromoterrhamnose-inducible promoterAvailable SinceAug. 3, 2023AvailabilityAcademic Institutions and Nonprofits only