We narrowed to 6,255 results for: tTA
-
Plasmid#126886PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ HDT701
Plasmid#126898PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUPD1:P1-MAR
Plasmid#106213PurposeProvides Glycine max P1 matrix attachment region as a level 0 GoldenBraid partDepositorInsertGlycine max P1 matrix attachment region
UseSynthetic BiologyExpressionPlantAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDDRFP-A1
Plasmid#36289DepositorInsertDimerization dependent RFP A1
TagsHis tagExpressionBacterialAvailable SinceApril 26, 2012AvailabilityAcademic Institutions and Nonprofits only -
pM13-DDRFPB1
Plasmid#36293DepositorInsertM13-DDRFP-B1
ExpressionMammalianAvailable SinceMay 4, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDDRFPA1-CaM
Plasmid#36292DepositorInsertddRFPA1-CaM
ExpressionMammalianPromoterCMVAvailable SinceMay 4, 2012AvailabilityAcademic Institutions and Nonprofits only -
pUPD1:TM6-MAR
Plasmid#106215PurposeProvides N.tabacum TM6 matrix attachment region as a level 0 GoldenBraid partDepositorInsertN.tabacum TM6 matrix attachment region
UseSynthetic BiologyExpressionPlantAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUPD1:Rb7-MAR
Plasmid#106212PurposeProvides N.tabacum RB7 matrix attachment region as a level 0 GoldenBraid partDepositorInsertN.tabacum RB7 matrix attachment region
UseSynthetic BiologyExpressionPlantAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUPD1:TM2-MAR
Plasmid#106214PurposeProvides N.tabacum TM2 matrix attachment region as a level 0 GoldenBraid partDepositorInsertN.tabacum TM2 matrix attachment region
UseSynthetic BiologyExpressionPlantAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJA12 Mamu-A1*001:01
Plasmid#180442PurposeE. coli expression of soluble MHC proteinDepositorInsertMamu-A1*001:01
TagsBSP41ExpressionBacterialMutationReplacement of transmembrane domain with enzymati…Available SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJA13 Mamu-A1*002:01
Plasmid#180443PurposeE. coli expression of soluble MHC proteinDepositorInsertMamu-A1*002:01
TagsBSP41ExpressionBacterialMutationReplacement of transmembrane domain with enzymati…Available SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTCF122 Mamu-B*008:01
Plasmid#180455PurposeE. coli expression of soluble MHC proteinDepositorInsertMamu-B*008:01
TagsBSP41ExpressionBacterialMutationReplacement of transmembrane domain with enzymati…Available SinceFeb. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTCF194 Mamu-E*02:04
Plasmid#180461PurposeE. coli expression of soluble MHC proteinDepositorInsertMamu-E*02:04
TagsBSP41ExpressionBacterialMutationReplacement of transmembrane domain with enzymati…Available SinceFeb. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shSCR
Plasmid#17920DepositorInsertshSCR
UseLentiviral and RNAiExpressionMammalianAvailable SinceMay 28, 2008AvailabilityAcademic Institutions and Nonprofits only -
p2B-58
Plasmid#177928PurposeExpresses yeGFP under control of doxycycline-responsive TET4 promoter (contains four rtTA binding sites)DepositorArticleInsertEGFP
ExpressionBacterial and YeastPromoterTET4 (contains four rtTA binding sites)Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Rhesus AAVS1-CAG-copGFP
Plasmid#84209PurposeRhesus AAVS1 safe harbor gene targeting donor expressing CAG-driven copGFPDepositorInsertsRhesus AAVS1 5’ homology arm
Rhesus AAVS1 3’ homology arm
ExpressionMammalianAvailable SinceNov. 15, 2016AvailabilityAcademic Institutions and Nonprofits only