We narrowed to 15,444 results for: grn
-
Plasmid#169779PurposeInsert one gRNADepositorTypeEmpty backboneUseUnspecifiedAvailable sinceJuly 16, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pHX_gRNA_hPAX7_6-9S
Plasmid#160453PurposesgRNA targeting human PAX7 3' UTR with 17bp spacerDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA_hPAX7_6-9S
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_AAVS1_sgRNA_2
Plasmid#155088Purposelentiviral plasmid expressing Cas9 and gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable sinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_G3BP2_G1
Plasmid#127112DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA G3BP2 (G3BP2 Human)
UseCRISPRAvailable sinceAug. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_NEMF
Plasmid#127126DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA NEMF (NEMF Human)
UseCRISPRAvailable sinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
px458_2A_GFP_sgRNA_LTN1
Plasmid#127125DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA LTN1 (LTN1 Human)
UseCRISPRAvailable sinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_PELO
Plasmid#127124DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA PELO (PELO Human)
UseCRISPRAvailable sinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M1S_AmpR
Plasmid#119153PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with one mismatch in the seed regionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with one mismatch in the seed region
UseCrisprPromoterJ23119Available sinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_T2_AmpR
Plasmid#119159PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' endDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' end
UseCrisprPromoterJ23119Available sinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_T3_AmpR
Plasmid#119160PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' endDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' end
UseCrisprPromoterJ23119Available sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_T1_AmpR
Plasmid#119158PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' endDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' end
UseCrisprPromoterJ23119Available sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M4NS_AmpR
Plasmid#119156PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with four mismatches in the non-seed regionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with four mismatches in the non-seed region
UseCrisprPromoterJ23119Available sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M1NS_AmpR
Plasmid#119155PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with one mismatch in the non-seed regionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with one mismatch in the non-seed region
UseCrisprPromoterJ23119Available sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_pos9_AmpR
Plasmid#119152PurposeEncodes sgRNA targeting position 9 in pColE1_70a_deGFP_KanRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting position 9 in pColE1_70a_deGFP_KanR
UseCrisprAvailable sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF2
Plasmid#106102PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF2DepositorInsertgRNA targeting CELF2 (CELF2 Human)
UseCRISPRAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TIAL1
Plasmid#106096PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIAL1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA TIAL1
UseCRISPRAvailable sinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pShHELIX(Cas12k-TnsC)-sgRNA_entry (CJT113)
Plasmid#181792PurposeExpresses 3-component ShHELIX containing a Cas12k-TnsC fusion. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShTnsB, ShTniQ, ShCas12k-ShTnsC
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdCas9+sgRNA expression vector precursor
Plasmid#171798PurposePICASSO: Library expression vector precursor for paired dCas9+sgRNA expressionDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterpLtetOAvailable sinceAug. 16, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_ctrA
Plasmid#133339Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets ctrA gene's promoter from Caulobacter crescentusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA_ctrA
UseCRISPRPromoterconstitutiveAvailable sinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only