We narrowed to 34,462 results for: Mut
-
Plasmid#146727PurposeMammalian Expression of HsRck-mut1DepositorAvailable SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pMT-NTAP-DmMe31B-mut1_L
Plasmid#146818PurposeInsect Expression of DmMe31B-mut1DepositorAvailable SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETM-60-P-HsRCK_296-472-mut_E
Plasmid#146172PurposeBacterial Expression of HsRck_296-472DepositorAvailable SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28a Cdk2ap1ΔN (MT2B2)-MutTER
Plasmid#178035PurposeExpression vector for the purpose of protein purification.DepositorInsertCdk2ap1 (Cdk2ap1 Mouse)
UseNonviralTags6xHIS - Thrombin - MBP- TEV-TRSExpressionBacterialMutationFirst N-Terminal 27aa are deleted and Changed T(8…PromoterT7LacIAvailable SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSCV-P C-FlagHA HPV16 E7 Mutant 2
Plasmid#191546PurposeProtein expression of HPV16 E7 Mutant 2DepositorInsertHPV16
UseRetroviralTagsFlagHAExpressionMutationI93A, K97A, P98APromoterAvailable SinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSCV-P C-FlagHA HPV16 E7 Mutant 1
Plasmid#191545PurposeProtein expression of HPV16 E7 Mutant 1DepositorInsertHPV16
UseRetroviralTagsFlagHAExpressionMutationR49A, H51A, H73A, E80A, D81APromoterAvailable SinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsDCP2-5xmut_V
Plasmid#147806PurposeMammalian Expression of HsDCP2-5xmutDepositorInsertHsDCP2-5xmut (DCP2 Human)
UseTagsExpressionMammalianMutationtwo silent mutations compared to the sequence gi…PromoterAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HUWE1_UBA/UIM-mut
Plasmid#187151PurposeEntry cloneDepositorInsertHUWE1 (HUWE1 Human)
UseEntry cloneTagsExpressionMutationM1328A/F1330A/A1376G/S1382APromoterAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-HA-DmDCP1-GSSGmut-dsRNAres_Q
Plasmid#147338PurposeInsect Expression of DmDCP1-GSSGmut-dsRNAresDepositorAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Mcm2-2A mutation sgRNA
Plasmid#186936PurposesgRNA used for genetic mutation at Y81 and Y90 of Mcm2DepositorInsertMcm2-2A mutation sgRNA (Mcm2 Mouse)
UseCRISPR and Mouse TargetingTagsExpressionMammalianMutationPromoterU6Available SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cherry-Plekhh1 5 silent mutations
Plasmid#187373PurposeExpresses human Plekhh1 with 5 silent mutations labelled with CherryDepositorInsertPlekhh1 with 5 silent mutations
UseTagsmCherryExpressionMammalianMutationFive silent mutations at the Plekhh1 siRNA site (…PromoterCMVAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
p416-GPD-PPK(mutant)
Plasmid#183942PurposeExpresses catalytic mutant of E. coli PPK from yeast GPD promoterDepositorInsertPPK(mutant) (ppk E. coli )
UseTagsExpressionYeastMutationmutations in His435, His454, and His592 to AlaninePromoterGPDAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
p416-GPD-HA-PPK(mutant)
Plasmid#183944PurposeExpresses HA-tagged catalytic mutant of E. coli PPK from yeast GPD promoterDepositorInsertPPK(mutant) (ppk E. coli)
UseTagsHAExpressionYeastMutationmutations in His435, His454, and His592 to AlaninePromoterGPDAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA T7-Gnat1 Mut-3UTR
Plasmid#184027PurposeExpresses mouse Gnat1 protein with N-terminal T7 tag from cDNA that contains the mutant 3'-UTR where the TAG binding sites for MSI1 are mutated to TGADepositorInsertGnat1 (Gnat1 Mouse)
UseTagsT7ExpressionMammalianMutationTAG sites in the 3'-UTR are mutated to TGAPromoterCMVAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso2-6xmut_U
Plasmid#147732PurposeMammalian Expression of HsNot1iso2-6xmutDepositorInsertHsNot1iso2-6xmut (CNOT1 Human)
UseTagsExpressionMammalianMutation4 silent and two non silent G917E and R2353Q muta…PromoterAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmGW182-10xmut_G
Plasmid#146428PurposeInsect Expression of DmGW182-10xmutDepositorInsertDmGW182-10xmut (gw Fly)
UseTagsExpressionInsectMutationMultiple mutations compared to NM_166780.1, see a…PromoterAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRTagsExpressionMutationS264A, and silent mutation to remove PAM sitePromoterAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMOD4-mT2A-mutated_rpsL-BSD-F
Plasmid#182338PurposeTemplate plasmid for PCR amplification of initial recombineering cassetteDepositorInsertBSD
UseMouse Targeting; Flp / frtTagsExpressionBacterialMutationPromoterAvailable SinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsC2orf68-EBMmut_K
Plasmid#146761PurposeMammalian Expression of HsC2orf68-EBMmutDepositorAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsDCP1a-mut1_G
Plasmid#146415PurposeMammalian Expression of HsDCP1a-mut1DepositorAvailable SinceMarch 3, 2022AvailabilityAcademic Institutions and Nonprofits only