We narrowed to 172,146 results for: Gene
-
Plasmid#173131PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj4 (kcnj4 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj9
Plasmid#173135PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj9 (kcnj9 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-D-kcnj10a
Plasmid#173137PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj10a (kcnj10a Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-D-kcnj10b
Plasmid#173138PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj10b (LOC100329607 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj11l
Plasmid#173140PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj11l (kcnj11l Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP3
Plasmid#113974PurposeSingle short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sg1
Plasmid#113966PurposeSingle short guide RNA targeting GTATAGCATACATTATACGDepositorInsertsg1
PromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
p(+)MV-NSE-FlagrP-3g_haP-F497D-3p
Plasmid#58800PurposeExpresses recombinant measles virus with duplicated P gene. wt P gene and P-F497D gene are tagged with Flag and HA peptides and si1 (siGFP) and si2 (siP) target sequences, respectively.DepositorInsertMeasles virus antigenome
TagsFlag and HaPromoterT7Available SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMS26
Plasmid#32295DepositorTypeEmpty backboneUseBacterial gene additionExpressionBacterialPromoterrhaBAvailable SinceSept. 26, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
p(+)MV-NSE-FlagrP-3g_haP-F497A-3p
Plasmid#58799PurposeExpresses recombinant measles virus with duplicated P gene. wt P gene and P-F497A gene are tagged with Flag and HA peptides and si1 (siGFP) and si2 (siP) target sequences, respectively.DepositorInsertMeasles virus antigenome
TagsFlag and HaPromoterT7Available SinceAug. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMG207
Plasmid#39273DepositorTypeEmpty backboneUseE coli gene targetingAvailable SinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBAD-bARGSer-AxeTxe
Plasmid#192473PurposeSecond-generation bacterial acoustic reporter gene derived from SerratiaDepositorInsertsbARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterNative promoter from Enterococcus faecium and pBADAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOTag2T-crelox-PUR
Plasmid#24026DepositorTypeEmpty backboneUseCre/LoxAvailable SinceFeb. 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMOTag2T-crelox-HYG
Plasmid#24025DepositorTypeEmpty backboneUseCre/LoxAvailable SinceFeb. 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMOTag4H-crelox-HYG
Plasmid#24027DepositorTypeEmpty backboneUseCre/LoxTags3XHAAvailable SinceMay 11, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMOTag4H-crelox-PUR
Plasmid#24028DepositorTypeEmpty backboneUseCre/LoxTags3XHAAvailable SinceJune 21, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMOTag43M-crelox-PUR
Plasmid#24032DepositorTypeEmpty backboneUseCre/LoxTags3XHAAvailable SinceJune 23, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMOTag43M-crelox-HYG
Plasmid#24031DepositorTypeEmpty backboneUseCre/LoxTags3XMycAvailable SinceFeb. 26, 2010AvailabilityAcademic Institutions and Nonprofits only