We narrowed to 28,317 results for: cmv promoter
-
Plasmid#246335Purpose203-bp DIAL Reporter Plasmid with minCMV2 expressing mGreenLantern in the presence of ZFa and editable by Cre recombinaseDepositorInsertmGreenLantern
UseSynthetic BiologyExpressionMammalianMutationnoneAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
(203-bp-DIAL-CMV53)-mGL-BGH_pKG3682
Plasmid#246338Purpose203-bp DIAL Reporter Plasmid with CMV53 expressing mGreenLantern in the presence of ZFa and editable by Cre recombinaseDepositorInsertmGreenLantern
UseSynthetic BiologyExpressionMammalianMutationnoneAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
f(syn)w-CMV-mKate2-p2A-RimBP2
Plasmid#241989PurposeInsert coding for mouse RBP2 (accession ID NP_001074857.1) with an N-terminal mKATE2 with a p2A cleavage site cloned inframe into a f(syn)w-mKATE2-p2A.DepositorInsertRIM-BP2 (Rimbp2 Mouse)
UseLentiviralTagsmKate2-p2A-RIMBP2ExpressionMammalianPromoterhuman SynapsinAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-CNOT3-Tev-3xFlag
Plasmid#245724PurposeExpress CNOT3-Tev-3xFlag in mammalian cellsDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-CMVe-SCP1-TagBFP2-W3SL-BC(p1-10)
Plasmid#231354PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses TagBFP from SCP1 promoter and CMV enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Afp
Plasmid#99697PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Afp promoter, vector allows for activation of mouse Afp, can be packaged and delivered as AAVDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
MPC021: CamKII CMV_sNovArch_citrine (soma targeting)
Plasmid#153194Purposeencoded soma targeted NovArchDepositorInsertsNovArch
TagscitrineExpressionMammalianAvailable SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV Ub Lex VP16 (F442A) HA (P#1711)
Plasmid#14596DepositorInsertLexA
TagsHA, Ubiquitin, and VP16 (F442A)ExpressionMammalianMutationThe VP16 sequence contains an F442A mutation. Theā¦Available SinceJune 30, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCMV-NTOM20-SbMVpC-43LK-iLID(139)-NES-NES-SbMVpN-iLID-SbMVseq-bArr2-TevCs-P2A-EGFP
Plasmid#210505Purposeexpresses NTOM20-SbMVpC-43LK-iLID(139)-NES-NES-SbMVpN-iLID-SbMVseq-bArr2-TevCs-P2A-EGFP component in mammalian cellsDepositorInsertNTOM20-SbMVpC-43LK-iLID(139)-NES-NES-SbMVpN-iLID-SbMVseq-bArr2-TevCs-P2A-EGFP
ExpressionMammalianPromoterCMVAvailable SinceFeb. 14, 2024AvailabilityAcademic Institutions and Nonprofits only