We narrowed to 34,594 results for: Cat

#87398

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#62637

mammalian expression of human duplicated Alpha7-2 bp deletion (CHRFAM7A-∆2bp) with YFP fused into M3-M4 loop

Henry Lester

Wang et al J Biol Chem. 2014 Sep 19;289(38):26451-6

March 10, 2015

Academic Institutions and Nonprofits only

#26957

Keith Joung

Maeder et al Mol Cell. 2008 Jul 25. 31(2):294-301.

Jan. 25, 2011

Academic Institutions and Nonprofits only

#86008

lenti reporter plasmid with M-AAT-specific gRNA target-sequence, to be used with tGFP #26864

Tobias Cantz

Eggenschwiler et al Sci Rep. 2016 Dec 2;6:38198. doi: 10.103

Feb. 1, 2017

Academic Institutions and Nonprofits only