We narrowed to 15,445 results for: grn
-
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only
-
AAV-shRNA_Tet3
Plasmid#85740PurposeshRNA against mouse Tet3DepositorAvailable sinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKLV2.2-mU6epegRNA(SapI)-hU6epegRNA(BbsI)-PGKpuroBFP-W
Plasmid#260204PurposeEmpty vector for dual pegRNA expression that can be cloned in individually using either SalI or BbsIDepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyTagsBFPAvailable sinceSept. 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA1a_(CJT90)
Plasmid#226989PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 1a must be used with gRNA 2a or 2bDepositorInsertSpCas9 gRNA 1a to create OPA1-del_exon5
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA2a_(CJT91)
Plasmid#226991PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 2a must be used with gRNA 1a or 1bDepositorInsertSpCas9 gRNA 2a to create OPA1-del_exon5
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A6-gRNA_(CJT88)
Plasmid#226987PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A6)DepositorInsertSpCas9 gRNA A6 to create OPA1-R194G
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A7-gRNA_(CJT89)
Plasmid#226986PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A7)DepositorInsertSpCas9 gRNA A7 to create OPA1-R194G
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA2b_(CJT93)
Plasmid#226992PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 2b must be used with gRNA 1a or 1bDepositorInsertSpCas9 gRNA 2b to create OPA1-del_exon5
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA1b_(CJT92)
Plasmid#226990PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 1b must be used with gRNA 2a or 2bDepositorInsertSpCas9 gRNA 1b to create OPA1-del_exon5
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A9-gRNA_(CJT87)
Plasmid#226988PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A9)DepositorInsertSpCas9 gRNA A9 to create OPA1-R194G
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(RUNX1(13))-hU6gRNA5(RUNX3(12))-PGKpuroBFP-W
Plasmid#208569PurposeLentiviral vector expressing gRNA targeting human RUNX1 and RUNX3DepositorAvailable sinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(RUNX1(13))-hU6gRNA5(RUNX3(13))-PGKpuroBFP-W
Plasmid#208570PurposeLentiviral vector expressing gRNA targeting human RUNX1 and RUNX3DepositorAvailable sinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(ARID1B(21))-PGKpuroBFP-W
Plasmid#200507PurposeLentiviral vector expressing gRNA targeting human ARID1A and ARID1BDepositorAvailable sinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(AAVS1)-PGKpuroBFP-W
Plasmid#200506PurposeLentiviral vector expressing gRNA targeting human ARID1A and AAVS1DepositorAvailable sinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(ARID1B(23))-PGKpuroBFP-W
Plasmid#200508PurposeLentiviral vector expressing gRNA targeting human ARID1A and ARID1BDepositorAvailable sinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(AAVS1)-hU6gRNA5(BbsI)-PGKpuroBFP-W
Plasmid#200502PurposeLentiviral vector expressing gRNA targeting human AAVS1DepositorInsertAAVS1 (AAVS1 Human)
UseLentiviralAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(AAVS1)-PGKpuroBFP-W
Plasmid#200503PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and AAVS1DepositorAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(SMARCA2(47))-PGKpuroBFP-W
Plasmid#200505PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and SMARCA2DepositorAvailable sinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBHM2329
Plasmid#171686PurposepRS316-PCnU6-scaffold, contains template for amplification of PCnU6 and scaffold for fusion PCRDepositorInsertPCnU6-sgRNA_scaffold
UseCRISPRExpressionBacterial and YeastPromoterC. neoformans U6Available sinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSicoR-mCh-Oct4i
Plasmid#21906DepositorInsertOct4i
UseLentiviral and RNAiExpressionMammalianAvailable sinceSept. 30, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by