We narrowed to 6,999 results for: crispr cas9 plasmids
-
Plasmid#233462PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a1, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a1, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5a2
Plasmid#233463PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a2, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a2, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5b
Plasmid#233464PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5b1
Plasmid#233465PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b1, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b1, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5b2
Plasmid#233466PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b2, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b2, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMLS279
Plasmid#73729PurposeSapTrap FLP-on C-terminal connector donor plasmidDepositorInsertC-terminal FLP-on
UseCRISPRAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMLS287
Plasmid#73730PurposeSapTrap flexible linker C-terminal connector donor plasmidDepositorInsertFlexible Linker
UseCRISPRAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMLS288
Plasmid#73735PurposeSapTrap flexible linker N-terminal connector donor plasmidDepositorInsertFlexible Linker
UseCRISPRAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMLS382
Plasmid#73731PurposeSapTrap Flagtag-TEV C-terminal connector donor plasmidDepositorInsertFLAGtag-TEV
UseCRISPRAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMLS282
Plasmid#73733PurposeSapTrap FLP-on N-terminal connector donor plasmidDepositorInsertN-terminal FLP-on
UseCRISPRAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMLS383
Plasmid#73736PurposeSapTrap TEV-Flagtag N-terminal connector donor plasmidDepositorInsertTEV-FLAGtag
UseCRISPRAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
EKv376(gRNAscaffold-tRNA for cloning)
Plasmid#248333PurposePlasmid contains gRNA scaffold-tRNA and is used to amplify fragments for Golden Gate assemblyDepositorInsertgRNAscaffold-tRNA
UseCRISPRAvailable SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDonor_mU6
Plasmid#69350PurposesgRNA scaffold and mouse U6 promoterDepositorInsertmU6 promoter and sgRNA scaffold flanked by BbsI sites
UseCRISPRPromotermU6 promoterAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-CASANOVA
Plasmid#113036PurposeAAV vector for CASANOVA (AcrIIA4-LOV2 hybrid) expression in mammalian cells; enables optogenetic control of SpyCas9DepositorInsertCASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd (no NLS) g4+g10+g18 (FWA)
Plasmid#117168PurposeCRISPR Cas9 SunTag system to target NtDRMcd (without an NLS) to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_NOS_NLS_GB1_noNLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSQT834
Plasmid#53371PurposeCsy4 and Cas9 nuclease expression plasmidDepositorInsertCsy4-T2A-Cas9-NLS
UseCRISPRExpressionMammalianPromoterCAGAvailable SinceJune 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUC gRNA Shuttle
Plasmid#47024PurposeEncodes a template from which gRNAs can be made via InFusion cloning. The Medicago truncatula U6.6 promoter drives the gRNA. For use in plants.DepositorInsertgRNA Shuttle
UseCRISPR; Cas9ExpressionPlantMutationG to T cloning mutation at position 323PromoterMedicago truncatula U6.6Available SinceSept. 3, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only