We narrowed to 10 results for: arl4c
-
Plasmid#67330PurposehArl4c with stop codon in Gateway Entry vectorDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pDEST47-ARL4C
Plasmid#67465PurposeMammalian expression of hArl4c with stop codon (native expression)DepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST14-ARL4C
Plasmid#67381PurposeExpression of native hArl4c in E. coliDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL4C-GFP
Plasmid#67402PurposeMammalian expression of hArl4c with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET3-ARL4C-His6
Plasmid#201869PurposeUsed for bacterial expression of human protein ARL4CDepositorAvailable SinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDSHA-ARL4C-Myc
Plasmid#67360PurposeMammalian expression of hArl4c with C-term Myc tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST40-ARL4C-V5-His6
Plasmid#67444PurposeMammalian expression of hArl4c with C-term V5 and His6 tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ARL4C-no stop
Plasmid#67331PurposehArl4c without stop codon in Gateway Entry vectorDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-DEST42-ARL4C-V5-His6
Plasmid#67423PurposeExpression of hArl4c with C-term V5 and His6 tag in E. coliDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only