8,265 results
-
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pCas9-EcRT-Z3-Nat
Plasmid#232094PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-FLAG-APEX2-NES-K.l.LEU2
Plasmid#229229PurposeTemplate plasmid for the endogenous tagging with FLAG-APEX2-NAS in yeastDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-FLAG-APEX2-NES-TRP1
Plasmid#229228PurposeTemplate plasmid for the endogenous tagging with FLAG-APEX2-NAS in yeastDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
PAF23
Plasmid#223171PurposeExpresses yeGFP under control of CTR1 promoter and terminatorDepositorInsertgreen fluorescent protein
ExpressionYeastPromoterSaccharomyces cerevisiae CTR1Available SinceFeb. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
PAF24
Plasmid#223172PurposeExpresses VC83_00191-yeGFP under control of CTR1 promoter and terminatorDepositorInsertCopper Transporter
TagsStreptagII and yeGFPExpressionYeastPromotersaccharomyces cerevisiae CTR1Available SinceFeb. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDRF1 ymScarletI3
Plasmid#224106PurposeExpressing ymScarletI3 in yeastDepositorInsertymScarletI3
ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
P415 ymiRFP680
Plasmid#224109PurposeExpressing ymiRFP680 in yeastDepositorInsertymiRFP680
ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-ymBaojin-URA3
Plasmid#224081PurposeYeast tagging vector to create a gene fusion with yeast optimized mBaojin with URA3 selectionDepositorInsertymBaoJin
TagsymBaoJinExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDRF1 ymBaojin
Plasmid#224085PurposeExpressing ymBaojin in yeastDepositorInsertymBaoJin
ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
P415 ymTurquoise2
Plasmid#224093PurposeExpressing ymTurquoise2 in yeastDepositorInsertymTurquoise2
ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-yemiRFP670-SpHis5
Plasmid#224098PurposeYeast tagging vector to create a gene fusion with yeast optimized emiRFP670 with SpHis5 selectionDepositorInsertyemiRFP670
TagsyemiRFP670ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDRF1 yemiRFP670
Plasmid#224103PurposeExpressing yemiRFP670 in yeastDepositorInsertyemiRFP670
ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDRF1 ymiRFP680
Plasmid#224105PurposeExpressing ymiRFP680 in yeastDepositorInsertymiRFP680
ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
P415 yemiRFP670
Plasmid#224107PurposeExpressing yemiRFP670 in yeastDepositorInsertyemiRFP670
ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETcon-pGAL1-Aga2-Amyloid β42-c_myc
Plasmid#225223PurposeYeast optimized human Amyloid β42 fused with aga2 protein gene under gal1 promoter for the expression of Amyloid β42 in yeast surface display.DepositorInsertsTagsHA Tag and c-myc TagExpressionYeastPromoterGAL1Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCfb12567
Plasmid#219927PurposePrCYC with the overhangs for SapI restriction site can be insert into the base plasmid of TUNEYALIDepositorInsertPromoter CYC
ExpressionYeastAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCfb12566
Plasmid#219926PurposePrDGA with the overhangs for SapI restriction site can be insert into the base plasmid of TUNEYALIDepositorInsertPromoter DGA
ExpressionYeastAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLS406
Plasmid#231078PurposeMinimal integrating shuttle vector depleted of restriction sites outside the polylinker region, yeast selection marker URA3DepositorTypeEmpty backboneUseIntegratingExpressionBacterial and YeastAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Kan
Plasmid#232096PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCfb13236
Plasmid#219909PurposeThe base plasmid of TUNEYALI for TF46DepositorInsertContains gRNA targeting TF46 ( YALI1_E20229g) and homologous arm matching TF46
ExpressionYeastAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLS405
Plasmid#231077PurposeMinimal integrating shuttle vector depleted of restriction sites outside the polylinker region, yeast selection marker LEU2DepositorTypeEmpty backboneUseIntegratingExpressionBacterial and YeastAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLS404
Plasmid#231076PurposeMinimal integrating shuttle vector depleted of restriction sites outside the polylinker region, yeast selection marker TRP1DepositorTypeEmpty backboneUseIntegratingExpressionBacterial and YeastAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLS408
Plasmid#231079PurposeMinimal integrating shuttle vector depleted of restriction sites outside the polylinker region, yeast selection marker natMX6DepositorTypeEmpty backboneUseIntegratingExpressionBacterial and YeastAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLS403
Plasmid#231075PurposeMinimal integrating shuttle vector depleted of restriction sites outside the polylinker region, yeast selection marker HIS3DepositorTypeEmpty backboneUseIntegratingExpressionBacterial and YeastAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLS400
Plasmid#231080PurposeMinimal integrating shuttle vector depleted of restriction sites outside the polylinker region, yeast selection marker KanMXDepositorTypeEmpty backboneUseIntegratingExpressionBacterial and YeastAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdnCas3-CDA1
Plasmid#229535PurposepMV_hyg encoding dnCas3(H74A+D75A)-CDA1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsdnCas3
Cytidine deaminase
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdnCas3-APOBEC1
Plasmid#229537PurposepMV_hyg encoding dnCas3(H74A+D75A)-rAPOBEC1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsrAPOBEC1
dnCas3
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas3-APOBEC1
Plasmid#229536PurposepMV_hyg encoding Cas3(wt)-rAPOBEC1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsrAPOBEC1
Cas3
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas3-CDA1
Plasmid#229534PurposepMV_hyg encoding Cas3(wt)-CDA1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsCas3
Cytidine deaminase
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCfb13199
Plasmid#219874PurposeThe base plasmid of TUNEYALI forTF09DepositorInsertContains gRNA targeting TF09 (YALI1_F29652g) and homologous arm matching TF09
ExpressionYeastAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCfb13218
Plasmid#219893PurposeThe base plasmid of TUNEYALI for TF28DepositorInsertContains gRNA targeting TF28 (YALI1_B28150g) and homologous arm matching TF28
ExpressionYeastAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETcon-pGAL1-Aga2-α-Synuclein-c_myc
Plasmid#225222PurposeYeast optimized human alpha synuclein fused with aga2 protein gene under gal1 promoter for the expression of alpha synuclein in yeast surface display.DepositorInsertsα-Synuclein
Aga2
TagsGS linker, HA Tag, and c-myc TagExpressionYeastPromoterGAL1Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETcon-pGAL1-Aga2-Htt(25Q)-c_myc
Plasmid#225228PurposeYeast optimized human Htt (25Q) fused with aga2 protein gene under gal1 promoter for the expression of Htt (25Q) in yeast surface display.DepositorInsertsAga2
Htt (25Q)
TagsHA Tag and c-myc TagExpressionYeastAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETcon-pGAL1-Aga2-Htt(46Q)-c_myc
Plasmid#225229PurposeYeast optimized human Htt (46Q) fused with aga2 protein gene under gal1 promoter for the expression of Htt (46Q) in yeast surface display.DepositorInsertsAga2
Htt (46Q)
TagsHA Tag and c-myc TagExpressionYeastAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-L1374
Plasmid#226278PurposePlasmid expressing the SSD1 allele from L-1374, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pVG178
Plasmid#227761PurposeExpresses a version of light-inducible transcription factor EL222 (Glu84Lys) under a strong constitutive PGK1prDepositorInsertEL222 codon-optimized for budding yeast
ExpressionYeastMutationGlu84KLys mutantPromoterPGK1prAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVG144
Plasmid#227760PurposeExpresses a version of light-inducible transcription factor EL222 (Val121Met) under a strong constitutive PGK1prDepositorInsertEL222 codon-optimized for budding yeast
ExpressionYeastMutationVal121Met mutantPromoterPGK1prAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVG150
Plasmid#227759PurposeExpresses a version of light-inducible transcription factor EL222 (Ser137Asn) under a strong constitutive PGK1prDepositorInsertEL222 codon-optimized for budding yeast
ExpressionYeastMutationSer137Asn mutantPromoterPGK1prAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVG124
Plasmid#227758PurposeExpresses a version of light-inducible transcription factor EL222 (Thr83Ser) under a strong constitutive PGK1prDepositorInsertEL222 codon-optimized for budding yeast
ExpressionYeastMutationThr83Ser mutantPromoterPGK1prAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVG121
Plasmid#227757PurposeExpresses a version of light-inducible transcription factor EL222 (Gly82Val) under a strong constitutive PGK1prDepositorInsertEL222 codon-optimized for budding yeast
ExpressionYeastMutationGly80Glu mutantPromoterPGK1prAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVG123
Plasmid#227755PurposeExpresses a version of light-inducible transcription factor EL222 (Ala157Val) under a strong constitutive PGK1prDepositorInsertEL222 codon-optimized for budding yeast
ExpressionYeastMutationAla157Val mutantPromoterPGK1prAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVG143
Plasmid#227754PurposeExpresses a version of light-inducible transcription factor EL222 (Leu87Ile) under a strong constitutive PGK1prDepositorInsertEL222 codon-optimized for budding yeast
ExpressionYeastMutationLeu87IlePromoterPGK1prAvailable SinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVG147
Plasmid#227753PurposeExpresses a version of light-inducible transcription factor EL222 (Gly94Cys) under a strong constitutive PGK1prDepositorInsertEL222 codon-optimized for budding yeast
ExpressionYeastMutationGly94Cys mutantPromoterPGK1prAvailable SinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVG120
Plasmid#227752PurposeExpresses a version of light-inducible transcription factor EL222 (Asp89Tyr) under a strong constitutive PGK1prDepositorInsertEL222 codon-optimized for budding yeast
ExpressionYeastMutationAsp89Tyr mutantPromoterPGK1prAvailable SinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVG137
Plasmid#227751PurposeExpresses a version of light-inducible transcription factor EL222 (Val201Leu) under a strong constitutive PGK1prDepositorInsertEL222 codon-optimized for budding yeast
ExpressionYeastMutationVal201Leu mutantPromoterPGK1prAvailable SinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVG136
Plasmid#227750PurposeExpresses a version of light-inducible transcription factor EL222 (Pro165Ser) under a strong constitutive PGK1prDepositorInsertEL222 codon-optimized for budding yeast
ExpressionYeastMutationPro165Ser mutantPromoterPGK1prAvailable SinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVG135
Plasmid#227749PurposeExpresses a version of light-inducible transcription factor EL222 (Lys99Glu) under a strong constitutive PGK1prDepositorInsertEL222 codon-optimized for budding yeast
ExpressionYeastMutationLys99Glu mutantPromoterPGK1prAvailable SinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVG119
Plasmid#227748PurposeExpresses a version of light-inducible transcription factor EL222 (Val139Leu) under a strong constitutive PGK1prDepositorInsertEL222 codon-optimized for budding yeast
ExpressionYeastMutationVal139Leu mutantPromoterPGK1prAvailable SinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only