8,350 results
-
Plasmid#232974PurposeGalactose iduced expression of Gcn4 F108A in yeastDepositorInsertGcn4 F108A
TagsTEV cleavage siteExpressionYeastMutationF108A, T121L, A141PPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 solvvol W
Plasmid#232977PurposeGalactose iduced expression of Gcn4 solvvol W+ in yeastDepositorInsertGcn4 solvvol W+
Tags3xHA and TEV cleavage siteExpressionYeastMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_DBDGFP
Plasmid#232999PurposeGalactose iduced expression of Gcn4 DBDGFP in yeastDepositorInsertDBD
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 ILVtoAS
Plasmid#232959PurposeGalactose iduced expression of Gcn4 ILVtoAS in yeastDepositorInsertGcn4 ILVtoAS
TagsTEV cleavage siteExpressionYeastMutationL123S, I128S, V130A, V135A, L137S, I142SPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WT 44merGFP
Plasmid#233000PurposeGalactose iduced expression of Gcn4 WT 44merGFP in yeastDepositorInsertGcn4 WT 44mer
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WT 30mer
Plasmid#232986PurposeGalactose iduced expression of Gcn4 WT 30mer in yeastDepositorInsertGcn4 WT 30mer
TagsTEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS424 Prp8 WT TRP1
Plasmid#234120PurposeThe N-terminus of Prp8 was restored thereby destroying the NheI site and correcting the ORFDepositorInsertPrp8
ExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-CUP1pr-NFAPoptim
Plasmid#221110PurposeFAP insert for N-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-CUP1pr-CFAPoptim
Plasmid#221111PurposeFAP insert for C-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-TEF1pr-MFA-Igkappa-FAPoptim-STE3
Plasmid#221114PurposeFAP tagged STE3 (N-terminally tagged, optimized for yeast expression) under the Tef1 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-STE3pr-MFA-Igkappa-FAPoptim-STE3-deltaPEST
Plasmid#221118PurposeFAP tagged STE3-PEST mutant (delta413-470 - N-terminally tagged, optimized) under the Ste3 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3-deltaPEST
ExpressionYeastMutationSTE3 mutant that lacks the PEST domain in the C-t…PromoterSTE3Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-STE3pr-MFA-Igkappa-FAPoptim-STE3-K424R
Plasmid#221119PurposeFAP tagged STE3-K424R mutant (N-terminally tagged, optimized) under the Ste3 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3-K424R
ExpressionYeastMutationSTE3 mutantK424RPromoterSTE3Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-ANP1-FAPoptim
Plasmid#221120PurposeFAP-tagged marker for the cis-Golgi (FAP optimized for yeast expression)DepositorInsertANP1-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-ERG6-FAPoptim
Plasmid#221121PurposeFAP-tagged marker for lipid droplets (FAP optimized for yeast expression)DepositorInsertERG6-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-PMA1-FAPoptim
Plasmid#221122PurposeFAP-tagged marker for the plasma membrane (FAP optimized for yeast expression)DepositorInsertPMA1-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-RPA34-FAPoptim
Plasmid#221123PurposeFAP-tagged marker for the nucleus (FAP optimized for yeast expression)DepositorInsertRPA34-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-SEC7-FAPoptim
Plasmid#221124PurposeFAP-tagged marker for the trans-Golgi (FAP optimized for yeast expression)DepositorInsertSEC7-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-VPH1-FAPoptim
Plasmid#221125PurposeFAP-tagged marker for the vacuolar membrane (FAP optimized for yeast expression)DepositorInsertVPH1-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-TEF1pr-NFAPoptim
Plasmid#221088PurposeFAP insert for N-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-TEF1pr-CFAPoptim
Plasmid#221089PurposeFAP insert for C-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-NFAPorig
Plasmid#221091PurposeFAP insert for N-terminally tagging genes of interest (original FAP + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-NFAPoptim
Plasmid#221093PurposeFAP insert for N-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-CFAPoptim
Plasmid#221094PurposeFAP insert for C-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-ADH1pr-NFAPoptim
Plasmid#221096PurposeFAP insert for N-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-ADH1pr-CFAPoptim
Plasmid#221097PurposeFAP insert for C-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-ADH1pr-NFAPoptim
Plasmid#221098PurposeFAP insert for N-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-ADH1pr-CFAPoptim
Plasmid#221099PurposeFAP insert for C-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)+E2:E15DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-MET25pr
Plasmid#221100PurposeMethionine-repressible gene expressionDepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-MET25pr-NFAPoptim
Plasmid#221101PurposeFAP insert for N-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-MET25pr-CFAPoptim
Plasmid#221102PurposeFAP insert for C-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-MET25pr
Plasmid#221103PurposeMethionine-repressible gene expressionDepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-MET25pr-NFAPoptim
Plasmid#221104PurposeFAP insert for N-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-MET25pr-CFAPoptim
Plasmid#221105PurposeFAP insert for C-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-CUP1pr
Plasmid#221106PurposeCopper-inducible gene expressionDepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-CUP1pr-NFAPoptim
Plasmid#221107PurposeFAP insert for N-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-CUP1pr-CFAPoptim
Plasmid#221108PurposeFAP insert for C-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-TEF1pr-NFAPorig
Plasmid#221086PurposeFAP insert for N-terminally tagging genes of interest (original FAP + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-TEF1pr-CFAPorig
Plasmid#221087PurposeFAP insert for C-terminally tagging genes of interest (original FAP + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL-mGold2t
Plasmid#231762PurposeExpression of mGold2t in yeast cellsDepositorInsertmGold2t
ExpressionYeastMutationmGold2t is mGold with V1A;V22I;H77N;Q80R;K101E;D1…PromoterpTDH(GAP promoter)Available SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
mP_ILB_Vector 1
Plasmid#232193PurposeThe plasmid vector designed for the expression of four genes in oleaginous yeasts, including Yarrowia lipolytica and Rhodotorula toruloides.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceMarch 3, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
MPS1 Candia parapsilosis
Plasmid#232153PurposeMPS1 from Candia parapsilosis codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1
ExpressionYeastAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPS1 Rhizoclosmatium globosum
Plasmid#232152PurposeMPS1 from Rhizoclosmatium globosum codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1
ExpressionYeastAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPS1 Malassezia globosa
Plasmid#232151PurposeMPS1 from Malassezia globosa codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1
ExpressionYeastMutationLikely not full proteinAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPS1 Candida auris
Plasmid#232150PurposeMPS1 from Candida auris codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1
ExpressionYeastAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPS1 Human
Plasmid#232149PurposeMPS1 from Human codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1 (TTK Human)
ExpressionYeastAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPS1 Candida glabrata
Plasmid#232148PurposeMPS1 from Candida glabrata codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1
ExpressionYeastAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPS1 Schizosaccharomyces pombe
Plasmid#232147PurposeMPS1 from Schizosaccharomyces pombe codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1 (mph1 Fission Yeast)
ExpressionYeastAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPS1 Candida albicans
Plasmid#232146PurposeMPS1 from Candida albicans codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1
ExpressionYeastAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only