8,350 results
-
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pRS313_MSN5-LY00045
Plasmid#232904PurposePlasmid carrying MSN5 from LY00045 (S288C) with its native promoter and terminator.DepositorInsertMSN5 (MSN5 Budding Yeast)
ExpressionYeastAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Kan
Plasmid#232102PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Nat-ADE2
Plasmid#232106PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Hyg-ADE2
Plasmid#232104PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterGAL7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg-ADE2
Plasmid#232107PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg
Plasmid#232101PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Nat
Plasmid#232094PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-FLAG-APEX2-NES-K.l.LEU2
Plasmid#229229PurposeTemplate plasmid for the endogenous tagging with FLAG-APEX2-NAS in yeastDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-FLAG-APEX2-NES-TRP1
Plasmid#229228PurposeTemplate plasmid for the endogenous tagging with FLAG-APEX2-NAS in yeastDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
PAF23
Plasmid#223171PurposeExpresses yeGFP under control of CTR1 promoter and terminatorDepositorInsertgreen fluorescent protein
ExpressionYeastPromoterSaccharomyces cerevisiae CTR1Available SinceFeb. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
PAF24
Plasmid#223172PurposeExpresses VC83_00191-yeGFP under control of CTR1 promoter and terminatorDepositorInsertCopper Transporter
TagsStreptagII and yeGFPExpressionYeastPromotersaccharomyces cerevisiae CTR1Available SinceFeb. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDRF1 ymScarletI3
Plasmid#224106PurposeExpressing ymScarletI3 in yeastDepositorInsertymScarletI3
ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-ymBaojin-URA3
Plasmid#224081PurposeYeast tagging vector to create a gene fusion with yeast optimized mBaojin with URA3 selectionDepositorInsertymBaoJin
TagsymBaoJinExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDRF1 ymBaojin
Plasmid#224085PurposeExpressing ymBaojin in yeastDepositorInsertymBaoJin
ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-yemiRFP670-SpHis5
Plasmid#224098PurposeYeast tagging vector to create a gene fusion with yeast optimized emiRFP670 with SpHis5 selectionDepositorInsertyemiRFP670
TagsyemiRFP670ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDRF1 yemiRFP670
Plasmid#224103PurposeExpressing yemiRFP670 in yeastDepositorInsertyemiRFP670
ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDRF1 ymiRFP680
Plasmid#224105PurposeExpressing ymiRFP680 in yeastDepositorInsertymiRFP680
ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
P415 yemiRFP670
Plasmid#224107PurposeExpressing yemiRFP670 in yeastDepositorInsertyemiRFP670
ExpressionYeastAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCfb12567
Plasmid#219927PurposePrCYC with the overhangs for SapI restriction site can be insert into the base plasmid of TUNEYALIDepositorInsertPromoter CYC
ExpressionYeastAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCfb12566
Plasmid#219926PurposePrDGA with the overhangs for SapI restriction site can be insert into the base plasmid of TUNEYALIDepositorInsertPromoter DGA
ExpressionYeastAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLS406
Plasmid#231078PurposeMinimal integrating shuttle vector depleted of restriction sites outside the polylinker region, yeast selection marker URA3DepositorTypeEmpty backboneUseIntegratingExpressionBacterial and YeastAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Kan
Plasmid#232096PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCfb13236
Plasmid#219909PurposeThe base plasmid of TUNEYALI for TF46DepositorInsertContains gRNA targeting TF46 ( YALI1_E20229g) and homologous arm matching TF46
ExpressionYeastAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLS405
Plasmid#231077PurposeMinimal integrating shuttle vector depleted of restriction sites outside the polylinker region, yeast selection marker LEU2DepositorTypeEmpty backboneUseIntegratingExpressionBacterial and YeastAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLS404
Plasmid#231076PurposeMinimal integrating shuttle vector depleted of restriction sites outside the polylinker region, yeast selection marker TRP1DepositorTypeEmpty backboneUseIntegratingExpressionBacterial and YeastAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLS408
Plasmid#231079PurposeMinimal integrating shuttle vector depleted of restriction sites outside the polylinker region, yeast selection marker natMX6DepositorTypeEmpty backboneUseIntegratingExpressionBacterial and YeastAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLS403
Plasmid#231075PurposeMinimal integrating shuttle vector depleted of restriction sites outside the polylinker region, yeast selection marker HIS3DepositorTypeEmpty backboneUseIntegratingExpressionBacterial and YeastAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLS400
Plasmid#231080PurposeMinimal integrating shuttle vector depleted of restriction sites outside the polylinker region, yeast selection marker KanMXDepositorTypeEmpty backboneUseIntegratingExpressionBacterial and YeastAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdnCas3-CDA1
Plasmid#229535PurposepMV_hyg encoding dnCas3(H74A+D75A)-CDA1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsdnCas3
Cytidine deaminase
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdnCas3-APOBEC1
Plasmid#229537PurposepMV_hyg encoding dnCas3(H74A+D75A)-rAPOBEC1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsrAPOBEC1
dnCas3
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas3-APOBEC1
Plasmid#229536PurposepMV_hyg encoding Cas3(wt)-rAPOBEC1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsrAPOBEC1
Cas3
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas3-CDA1
Plasmid#229534PurposepMV_hyg encoding Cas3(wt)-CDA1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsCas3
Cytidine deaminase
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCfb13199
Plasmid#219874PurposeThe base plasmid of TUNEYALI forTF09DepositorInsertContains gRNA targeting TF09 (YALI1_F29652g) and homologous arm matching TF09
ExpressionYeastAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only