8,173 results
-
Plasmid#226274PurposePlasmid expressing the SEC18 allele from S288C, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-L1374
Plasmid#226271PurposePlasmid expressing the SEC22 allele from L-1374, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-UWOPS872421
Plasmid#226272PurposePlasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-NCYC110
Plasmid#226277PurposePlasmid expressing the SEC18 allele from NCYC110, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-UWOPS872421
Plasmid#226276PurposePlasmid expressing the SEC18 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-S288C
Plasmid#226270PurposePlasmid expressing the SEC22 allele from S288C, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-S288C
Plasmid#226266PurposePlasmid expressing the SCT1 allele from S288C, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-L1374
Plasmid#226267PurposePlasmid expressing the SCT1 allele from L-1374, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM038_P8b_5'Lys3
Plasmid#216463Purpose5' homology arm for S. pombe genomic integration. Part type 8b following the YeastToolkit MoClo grammar.DepositorInsert5'lys3
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-NCYC110
Plasmid#226279PurposePlasmid expressing the SSD1 allele from NCYC110, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-NCYC110
Plasmid#226269PurposePlasmid expressing the SCT1 allele from NCYC110, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-UWOPS872421
Plasmid#226268PurposePlasmid expressing the SCT1 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRoC30_Th3.1
Plasmid#188065PurposeFuncLib-designed high-redox potential laccase from Trametes hirsuta (Th3.1)DepositorInsertFuncLib-designed high-redox potential laccase from Trametes hirsuta
TagsS. cerevisiae evolved α-factor prepro-leader sign…ExpressionYeastMutation20 PROSS + 4 FuncLib mutations, described in publ…Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRoC30_Th3.7
Plasmid#188066PurposeFuncLib-designed high-redox potential laccase from Trametes hirsuta (Th3.7)DepositorInsertFuncLib-designed high-redox potential laccase from Trametes hirsuta
TagsS. cerevisiae evolved α-factor prepro-leader sign…ExpressionYeastMutation20 PROSS + 3 FuncLib mutations, described in publ…Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRoC30_Th3.10
Plasmid#188067PurposeFuncLib-designed high-redox potential laccase from Trametes hirsuta (Th3.10)DepositorInsertFuncLib-designed high-redox potential laccase from Trametes hirsuta
TagsS. cerevisiae evolved α-factor prepro-leader sign…ExpressionYeastMutation20 PROSS + 3 FuncLib mutations, described in publ…Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYAMTrGCas
Plasmid#224866PurposeYeast genome editingDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYAMTr2GCsgSeLEU2
Plasmid#224870PurposeDisruption of S. eubayanus type LEU2 genesDepositorInsertpYAMTr2GC having the guide sequence SeLEU2 (DI49_0736 Budding Yeast)
UseCRISPRExpressionYeastAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYAMTrGCsgScLEU2
Plasmid#224869PurposeDisruption of S. cerevisiae type LEU2 genesDepositorAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYAMTr2GCsgSc-SeLEU2
Plasmid#224871PurposeDisruption of LEU2 genes in the Saccharomyces sense strict group speciesDepositorUseCRISPRExpressionYeastAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBSsgRNA
Plasmid#224867PurposeYeast genome editing, Insertion of 20 bp oligo into sgRNA geneDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK7185
Plasmid#219765PurposeVector for expression PzPKS2 in yeast (P.pastoris)DepositorInsertPzPKS2
ExpressionYeastPromoterpGAPAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYAMTr2GCsgScLEU2
Plasmid#224868PurposeDisruption of S. cerevisiae type LEU2 geneDepositorAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS416 CUP1pro-Htt103QdeltaP125-134-YFP
Plasmid#224882PurposeLow copy plasmid for inducible yeast expression of the Htt exon 1 construct without the first 10 amino acids of the proline-rich region (125-134) tagged with YFP using copper.DepositorInsertHtt103QdeltaP125-134 (HTT Human)
TagsYFPExpressionYeastMutationdeltaP125-134PromoterCUP1Available SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS416 CUP1pro-Htt103QdeltaP135-170-YFP
Plasmid#224878PurposeLow copy plasmid for inducible yeast expression of the Htt exon 1 construct without the last 36 amino acids of the proline-rich region (135-170) tagged with YFP using copper.DepositorInsertHtt103QdeltaP135-170 (HTT Human)
TagsYFPExpressionYeastMutationdeltaP135-170PromoterCUP1Available SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS416 CUP1pro-Htt103QdeltaP141-160-YFP
Plasmid#224886PurposeLow copy plasmid for inducible yeast expression of the Htt exon 1 construct without the middle 20 amino acids of the proline-rich region (141-160) tagged with YFP using copper.DepositorInsertHtt103QdeltaP141-160 (HTT Human)
TagsYFPExpressionYeastMutationdeltaP141-160PromoterCUP1Available SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS415 GPDpro-RNQ1-CFP
Plasmid#224887PurposeLow copy plasmid for constitutive yeast expression of RNQ1 tagged with CFP using copper. This is construct can be used as an IPOD marker (Kaganovich et al., 2008).DepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS416 CUP1pro-Htt103QdeltaP125-160-YFP
Plasmid#224883PurposeLow copy plasmid for inducible yeast expression of the Htt exon 1 construct without the first 36 amino acids of the proline-rich region (125-160) tagged with YFP using copper.DepositorInsertHtt103QdeltaP125-160 (HTT Human)
TagsYFPExpressionYeastMutationdeltaP125-160PromoterCUP1Available SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS416 CUP1pro-M-PRR-Htt97QP4-YFP
Plasmid#224885PurposeLow copy plasmid for inducible yeast expression of the Htt exon 1 construct with the last 46 amino acids of the proline-rich region at the N-terminus, 4 prolines left at the C-terminus using copper.DepositorAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS416 CUP1pro-Htt103QdeltaP141-170-YFP
Plasmid#224880PurposeLow copy plasmid for inducible yeast expression of the Htt exon 1 construct without the last 30 amino acids of the proline-rich region (141-170) tagged with YFP using copper.DepositorInsertHtt103QdeltaP141-170 (HTT Human)
TagsYFPExpressionYeastMutationdeltaP141-170PromoterCUP1Available SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS416 CUP1pro-Htt103QdeltaP161-170-YFP
Plasmid#224876PurposeLow copy plasmid for inducible yeast expression of the Htt exon 1 construct without the last 10 amino acids of the proline-rich region (161-170) tagged with YFP using copper.DepositorInsertHTT103QdeltaP161-170 (HTT Human)
TagsYFPExpressionYeastMutationdelta161-170PromoterCUP1Available SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1426
Plasmid#218622PurposeExpress tNCS to the peroxisome for toxicity assayDepositorInserttNCS
TagsYFP-ePTS1ExpressionYeastMutation106-588Available SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1462
Plasmid#218623PurposeExpress mKate-TEV_cutSite_YFP to the peroxisome with low expression TEV proteaseDepositorInsertYFP
TagsePTS1ExpressionYeastAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1463
Plasmid#218624PurposeExpress mKate-TEV_cutSite_YFP to the peroxisome with high expression TEV proteaseDepositorInsertYFP
TagsePTS1ExpressionYeastAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1465
Plasmid#218625PurposeExpress engineered TFs Adr1c(S230A), Pip2c, and Oaf1cDepositorInsertAdr1
ExpressionYeastAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1734
Plasmid#218627PurposeExpress amorphadiene synthase (ADS)DepositorInsertADS
ExpressionYeastAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1503
Plasmid#218610PurposeExpress Pex30DepositorInsertPex30
ExpressionYeastAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1504
Plasmid#218611PurposeExpress Pex31DepositorInsertPex31
ExpressionYeastAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only