8,405 results
-
Plasmid#232152PurposeMPS1 from Rhizoclosmatium globosum codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1
ExpressionYeastAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPS1 Malassezia globosa
Plasmid#232151PurposeMPS1 from Malassezia globosa codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1
ExpressionYeastMutationLikely not full proteinAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPS1 Candida auris
Plasmid#232150PurposeMPS1 from Candida auris codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1
ExpressionYeastAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPS1 Human
Plasmid#232149PurposeMPS1 from Human codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1 (TTK Human)
ExpressionYeastAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPS1 Candida glabrata
Plasmid#232148PurposeMPS1 from Candida glabrata codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1
ExpressionYeastAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPS1 Schizosaccharomyces pombe
Plasmid#232147PurposeMPS1 from Schizosaccharomyces pombe codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1 (mph1 Fission Yeast)
ExpressionYeastAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MPS1 Candida albicans
Plasmid#232146PurposeMPS1 from Candida albicans codon optimized for S. cerevisiae in pUCIDTDepositorInsertMPS1
ExpressionYeastAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00045
Plasmid#232904PurposePlasmid carrying MSN5 from LY00045 (S288C) with its native promoter and terminator.DepositorInsertMSN5 (MSN5 Budding Yeast)
ExpressionYeastAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Kan
Plasmid#232102PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Nat-ADE2
Plasmid#232106PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Hyg-ADE2
Plasmid#232104PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterGAL7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg-ADE2
Plasmid#232107PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg
Plasmid#232101PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only