8,236 results
-
Plasmid#226266PurposePlasmid expressing the SCT1 allele from S288C, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-L1374
Plasmid#226267PurposePlasmid expressing the SCT1 allele from L-1374, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM038_P8b_5'Lys3
Plasmid#216463Purpose5' homology arm for S. pombe genomic integration. Part type 8b following the YeastToolkit MoClo grammar.DepositorInsert5'lys3
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-NCYC110
Plasmid#226279PurposePlasmid expressing the SSD1 allele from NCYC110, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-NCYC110
Plasmid#226269PurposePlasmid expressing the SCT1 allele from NCYC110, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-UWOPS872421
Plasmid#226268PurposePlasmid expressing the SCT1 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRoC30_Th3.1
Plasmid#188065PurposeFuncLib-designed high-redox potential laccase from Trametes hirsuta (Th3.1)DepositorInsertFuncLib-designed high-redox potential laccase from Trametes hirsuta
TagsS. cerevisiae evolved α-factor prepro-leader sign…ExpressionYeastMutation20 PROSS + 4 FuncLib mutations, described in publ…Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRoC30_Th3.7
Plasmid#188066PurposeFuncLib-designed high-redox potential laccase from Trametes hirsuta (Th3.7)DepositorInsertFuncLib-designed high-redox potential laccase from Trametes hirsuta
TagsS. cerevisiae evolved α-factor prepro-leader sign…ExpressionYeastMutation20 PROSS + 3 FuncLib mutations, described in publ…Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRoC30_Th3.10
Plasmid#188067PurposeFuncLib-designed high-redox potential laccase from Trametes hirsuta (Th3.10)DepositorInsertFuncLib-designed high-redox potential laccase from Trametes hirsuta
TagsS. cerevisiae evolved α-factor prepro-leader sign…ExpressionYeastMutation20 PROSS + 3 FuncLib mutations, described in publ…Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYAMTrGCas
Plasmid#224866PurposeYeast genome editingDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYAMTr2GCsgSeLEU2
Plasmid#224870PurposeDisruption of S. eubayanus type LEU2 genesDepositorInsertpYAMTr2GC having the guide sequence SeLEU2 (DI49_0736 Budding Yeast)
UseCRISPRExpressionYeastAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYAMTrGCsgScLEU2
Plasmid#224869PurposeDisruption of S. cerevisiae type LEU2 genesDepositorAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYAMTr2GCsgSc-SeLEU2
Plasmid#224871PurposeDisruption of LEU2 genes in the Saccharomyces sense strict group speciesDepositorUseCRISPRExpressionYeastAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBSsgRNA
Plasmid#224867PurposeYeast genome editing, Insertion of 20 bp oligo into sgRNA geneDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK7185
Plasmid#219765PurposeVector for expression PzPKS2 in yeast (P.pastoris)DepositorInsertPzPKS2
ExpressionYeastPromoterpGAPAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYAMTr2GCsgScLEU2
Plasmid#224868PurposeDisruption of S. cerevisiae type LEU2 geneDepositorAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS416 CUP1pro-Htt103QdeltaP125-134-YFP
Plasmid#224882PurposeLow copy plasmid for inducible yeast expression of the Htt exon 1 construct without the first 10 amino acids of the proline-rich region (125-134) tagged with YFP using copper.DepositorInsertHtt103QdeltaP125-134 (HTT Human)
TagsYFPExpressionYeastMutationdeltaP125-134PromoterCUP1Available SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only