8,210 results
-
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Nat
Plasmid#232094PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-FLAG-APEX2-NES-K.l.LEU2
Plasmid#229229PurposeTemplate plasmid for the endogenous tagging with FLAG-APEX2-NAS in yeastDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-FLAG-APEX2-NES-NatMX6
Plasmid#229231PurposeTemplate plasmid for the endogenous tagging with FLAG-APEX2-NAS in yeastDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-FLAG-APEX2-NES-TRP1
Plasmid#229228PurposeTemplate plasmid for the endogenous tagging with FLAG-APEX2-NAS in yeastDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only