We narrowed to 2,984 results for: erf
-
Plasmid#58401PurposeExpresses murine IFITM3-K83A with an N-terminal HA tag in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertIFITM3 (Ifitm3 Mouse)
TagsHAExpressionMammalianMutationLysine 83 to AlaninePromoterCMV IEAvailable sinceSept. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HA-mIFITM3-K24A
Plasmid#58400PurposeExpresses murine IFITM3-K24A with an N-terminal HA tag in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertIFITM3 (Ifitm3 Mouse)
TagsHAExpressionMammalianMutationLysine 24 to AlaninePromoterCMV IEAvailable sinceSept. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available sinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hADAR1_2g)-PGKpuro2ABFP-W
Plasmid#208434PurposeLentiviral gRNA plasmid targeting human ADAR1 gene, co-expression of BFP tagDepositorInsertADAR1 (ADAR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U8Available sinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE5 (minus strand)
Plasmid#91836PurposeLuciferase reporter for IL2RA enhancer (IGI-P0613)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertIL2RA CaRE5 (minus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable sinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH671-SUP35-H348Q
Plasmid#29732DepositorInsertSUP35 gene encoding translation release factor 3 from S. cerevisiae (SUP35 Budding Yeast)
ExpressionYeastMutationH348Q mutant gene of SUP35 including genomic sequ…Available sinceSept. 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pminiTol2-5xUAS-sfGFP-zP2A-zB19G-zT2A-zTVA (UGBT)
Plasmid#240274PurposeHelper plasmid for zebrafish rabies virus based-circuit tracingDepositorInsertsB19G (codon-optimized for Danio rerio)
sfGFP (codon-optimized for Danio rerio)
TVA (codon-optimized for Danio rerio)
UseZebrafish expressionAvailable sinceApril 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGIPZ EF1a myc tagged mbIL15 IRES miRFP720-P2A-Blast
Plasmid#248032PurposeConstitutively expresses myc tagged membrane bound IL15, miRFP720 and a blasticidin resistance gene in human cellsDepositorInsertmyc-tagged membrane bound IL15 (IL15 Human)
UseLentiviralTagsMycExpressionMammalianPromoterhuman EF1aAvailable sinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYN2_1
Plasmid#184757PurposePlasmid for genome editing by CRISPR/Cas9DepositorInsertsCas9
sgRNA scaffold where sfGFP is replaced with gRNA protospacer of interest, which will be proceeded by the HDV Ribozyme
UseSynthetic BiologyTags2xNLSExpressionBacterial and YeastPromoterPGK1 and tRNA-Phe-HDV RibozymeAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pD/Paro-IFN
Plasmid#205439PurposeA donor vector plasmid for Cre-mediated integration of paromomycin resistance (Paro) and dog IFNα-4 (IFNα-4) genesDepositorInsertsdog interferon α-4 gene
paromomycin resistance gene
UseCre/Lox; Chlamydomonas expressionPromoterHeat shock protein 70A (HSP70A)/ribulose bisphosp…Available sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-NCOA7g1 (BB22)
Plasmid#139457PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: puroR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-NCOA7g2 (BB23)
Plasmid#139458PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: puroR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRC/CMV-TYK2V362F-VSV
Plasmid#139345PurposeExpression of TYK2 V362F protein (rs2304256)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTYK2 cDNA with 267nt of 5' UTR (TYK2 Human)
TagsVSVExpressionMammalianMutationV362FPromoterCMVAvailable sinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-pro-siRNA-V2-LMNA
Plasmid#111088PurposepET-pro-siRNA-V2 based plasmid for production of recombinant siRNAs (pro-siRNAs) against human Lamin A/C gene.DepositorInsertLamin A/C (LMNA Human)
ExpressionBacterialAvailable sinceMarch 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001145502)
Plasmid#76851Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001148405)
Plasmid#76852Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001146399)
Plasmid#76853Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001148106)
Plasmid#76854Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-mIFITM3-Y20A
Plasmid#58460PurposeExpresses murine IFITM3-Y20A with an N-terminal myc tag in mammalian cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertIFITM3 (Ifitm3 Mouse)
TagsmycExpressionMammalianMutationTyrosine 20 to alaninePromoterCMV IEAvailable sinceSept. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-mIFITM3-deltaY20
Plasmid#58459PurposeExpresses murine IFITM3-deltaY20 with an N-terminal myc tag in mammalian cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertIFITM3 (Ifitm3 Mouse)
TagsmycExpressionMammalianMutationTyrosine 20 deletedPromoterCMV IEAvailable sinceSept. 9, 2014AvailabilityAcademic Institutions and Nonprofits only