We narrowed to 7,402 results for: Lif;
-
Plasmid#104474PurposePlasmid for pop-in/pop-out replacement of RPL13A with an FKBPx4-tagged version.DepositorInsertRPL13Ap (RPL13A Budding Yeast)
UseTagsFKBPx4-HAExpressionYeastMutationincludes the last 354 bp of RPL13A onlyPromoterAvailable sinceFeb. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNP154
Plasmid#106360PurposeA vector backbone, including mKate, to be used to make constructs to be inserted as a single copy at a site on Chr II.DepositorTypeEmpty backboneUseTagsExpressionWormMutationPromoterAvailable sinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
LexAop2->Bxb1.STOP>myr::4xSNAPf
Plasmid#87640PurposeFor creating drosophila transgenics expressing LexAop2->Bxb1.STOP>myr::4xSNAPfDepositorInsertmyr::4xSNAPf
UseTagsExpressionInsectMutationPromoterAvailable sinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFLIP30
Plasmid#65499PurposeFRET biosensor Destination vector for E. coli expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneUseTags6His-AFPt9-attR1 and attR2-mCer-cMycExpressionBacterialMutationPromoterT7 promoterAvailable sinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFLIP32
Plasmid#65500PurposeFRET biosensor Destination vector for E. coli expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneUseTags6His-AFPt9-attR1 and attR2-t7CFPt9-cMycExpressionBacterialMutationPromoterT7 promoterAvailable sinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFLIP39
Plasmid#65507PurposeFRET biosensor Destination vector for E. coli expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneUseTags6His-edAFPt9-attR1 and attR2-t7edCFPt9-cMycExpressionBacterialMutationPromoterT7 promoterAvailable sinceJune 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BoxB-petracrRNA
Plasmid#207625PurposeExpresses BoxB-petracrRNA in mammalian cells (with a human-U6 promoter)DepositorInsertBoxB-petracrRNA
UseSynthetic BiologyTagsExpressionMutationPromoterhU6Available sinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only