We narrowed to 13,175 results for: LIC
-
Plasmid#192288PurposeExpresses RFP and four sgRNAs against GBX2DepositorAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-HA-Dre]-lox-Akna-mOrange2
Plasmid#196893PurposeNeuron-specific expression of Akna fused to mOrange2. Used in combination with Talpha1-iCre-pA plasmidsDepositorAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-iCre-pA]-lox-Akna-mOrange2
Plasmid#196880PurposeNeuron-specific expression of the centrosomal protein Akna fused to mOrange2DepositorAvailable SinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-iCre-pA]-lox-2xHA-128-425-Akap9
Plasmid#196897PurposeNeuron-specific expression of fragment 128-425 from A-Kinase Anchoring Protein 9 (Akap9) fused to 2xHA-tags.DepositorAvailable SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-HA-Dre]-lox-mOrange2-NEDD1-gTBD
Plasmid#196894PurposeNeuron-specific expression of the gamma-tubulin-binding domain (gTBD) of NEDD1 fused to mOrange aimed to displace endogenous gamma-TuRC from the centrosome. Used in combination with Talpha1-iCre-pA plasmidsDepositorInsertN-gTBD-mOrange2 (NEDD1 Human)
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-Dre-PA]-lox-2xHA-CAMSAP3
Plasmid#196895PurposeNeuron-specific expression of Calmodulin Regulated Spectrin Associated Protein Family Member 3 (CAMSAP3) fused to 2xHA-tags. Used in combination with Talpha1-iCre-pA plasmidsDepositorAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-mOrange2-Cdk5rap2-CTD
Plasmid#196855PurposeExpression of the centrosome targeting carboxy-terminal domain (CTD) of Cdk5rap2 fused to mOrange2. Used to displace endogenous Cdk5rap2 from centrosomes.DepositorInsertmOrange2-Cdk5rap2-CTD (Cdk5rap2 Discosoma sp.)
ExpressionMammalianMutationNone (wt)PromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only