We narrowed to 13,309 results for: sequence

#87385

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#74425

Calb2 UTR with mutated AU binding sequence

Emanuela Felley-Bosco, Rolf Stahel

Kresoja-Rakic et al Front Genet. 2017 May 29;8:70. doi: 10.3

April 27, 2016

Academic Institutions and Nonprofits only

#72127

Expresses the N-terminal extracellular region of the PlexinB1 protein following proteolytic cleavage (ie, short), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

March 11, 2016

Academic Institutions and Nonprofits only

#72103

Expresses the extracellular region of the Neuropilin 2, isoform 6 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

March 2, 2016

Academic Institutions and Nonprofits only

#72099

Expresses the extracellular region of the Neuropilin 2, isoform 2 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

March 1, 2016

Academic Institutions and Nonprofits only

#72114

Expresses the extracellular region of the Netrin G1, isoform e protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

March 1, 2016

Academic Institutions and Nonprofits only

#72116

Expresses the extracellular region of the Netrin G1, isoform g protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

March 1, 2016

Academic Institutions and Nonprofits only

#72113

Expresses the extracellular region of the Netrin G1, isoform d protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

March 1, 2016

Academic Institutions and Nonprofits only

#72121

Expresses the extracellular region of the Netrin G2, isoform b protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Feb. 29, 2016

Academic Institutions and Nonprofits only

#72148

Expresses the Sema3F protein (truncated at cleavage site P3; ie, long and contains a 93 nt deletion in exon 3), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Feb. 29, 2016

Academic Institutions and Nonprofits only