We narrowed to 2,458 results for: 683
-
Plasmid#82899PurposeGateway Donor vector containing ABCB9, part of the Target Accelerator Plasmid Collection.DepositorInsertABCB9 (ABCB9 Human)
UseGateway entry vectorMutation582_590delISLVSQEPVinsVCARAWATL; 592_595delFARSin…PromoterNoneAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
IMPT-10917
Plasmid#236192PurposeExpress GPR6 in insect cellsDepositorAvailable SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MCP-Lbr-V5-mCherry
Plasmid#235093PurposeLbr mCherry fusion protein with MCP domainDepositorAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdest METTL1-S27A Neo
Plasmid#223059PurposeMETTL1-S27A gene expression in mammalian cellsDepositorAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdest METTL1-S27D Neo
Plasmid#223060PurposeMETTL1-S27D gene expression in mammalian cellsDepositorAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
rag2:METTL1-S27A_CE_pISceI
Plasmid#223048PurposeExpress METTL1-S27A gene in mesenchymal lineage of Zebrafish.DepositorInsertMETTL1-S27A (METTL1 Human)
UseExpress the insert(gene) in mesenchymal lineage o…MutationS27APromoterRag2Available SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
rag2:METTL1-S27D_CE_pISceI
Plasmid#223049PurposeExpress METTL1-S27D gene in mesenchymal lineage of Zebrafish.DepositorInsertMETTL1-S27D (METTL1 Human)
UseExpress the insert(gene) in mesenchymal lineage o…MutationS27DPromoterRag2Available SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
rag2:METTL1-CM_CE_pISceI
Plasmid#223050PurposeExpress METTL1-CM gene in mesenchymal lineage of Zebrafish.DepositorInsertMETTL1-CM (METTL1 Human)
UseExpress the insert(gene) in mesenchymal lineage o…Mutation160-163 (LFPD>AFPA)PromoterRag2Available SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC[∆2-83]-His+MFN2-Strep (SB259)
Plasmid#227608PurposeInducible coexpression of His-tagged SLC25A46 in its N-terminal region (∆2-83) and Strep-tagged MFN2 in Pichia pastorisDepositorTags10xHis and Twin-StrepTagExpressionYeastMutationaa 2-83 deletedPromoterAOX1Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC-His+MFN2-Strep (SB255)
Plasmid#227604PurposeInducible coexpression of His-tagged SLC25A46 and Strep-tagged MFN2 in Pichia pastorisDepositorTags10xHis and Twin-StrepTagExpressionYeastPromoterAOX1Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a_StrepII-Hook2_FTS_FHIP2A
Plasmid#222302PurposeCo-expresses full-length human FHF (FTS, StrepII-HOOK2 and FHIP2A) in a pBIG1a vectorDepositorTagsStrepII-PscExpressionInsectAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-Lgi1 [N283/7R-2b]
Plasmid#222172PurposeMammalian Expression Plasmid of anti-Lgi1 (Mouse). Derived from hybridoma N283/7.DepositorInsertAnti-Lgi1 (Mus musculus) recombinant mouse monoclonal antibody. (Lgi1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
MDM4_Deletion_Upstream_gRNA_2
Plasmid#195135PurposegRNA in a third generation Cas9 vector with GFP, targeting region immediately upstream of MDM4, to be used with MDM4_Deletion_Downstream_gRNA_1/2 for MDM4 deletionDepositorInsertMDM4 Deletion Upstream gRNA 2 (MDM4 Human)
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
MDM4_Deletion_Upstream_gRNA_1
Plasmid#195134PurposegRNA in a third generation Cas9 vector with GFP, targeting region immediately upstream of MDM4, to be used with MDM4_Deletion_Downstream_gRNA_1/2 for MDM4 deletionDepositorInsertMDM4 Deletion Upstream gRNA 1 (MDM4 Human)
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
eIF3a- pMK293 (mAID-mCherry2-Hygro) plasmid
Plasmid#192236Purposeknockin donor vector of mAID-mCherry2-Hygro to C-terminus of endogenous human eIF3aDepositorInserteIF3a-knockin-homology arm-mAID-mCherry2-Hygro (EIF3A Human)
ExpressionMammalianAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
eIF3a- pMK289 (mAID-mClover-NeoR) plasmid
Plasmid#192235Purposeknockin donor vector of mAID-mClover-NeoR to C-terminus of endogenous human eIF3aDepositorInserteIF3a-knockin-homology arm-mAID-mClover-NeoR (EIF3A Human)
ExpressionMammalianAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-KLRC1-Fc(DAPA)-AviTag-6xHis
Plasmid#156532PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertKLRC1 (KLRC1 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only