We narrowed to 7,692 results for: Lif;
-
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-muSOX
Plasmid#131701Purposeexpresses muSOX with GFP N-terminally fusedDepositorAvailable SinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDRFLIP37
Plasmid#65515PurposeFRET biosensor Destination vector for yeast expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-Cit-attR1 and attR2-Cer-cMycExpressionYeastPromoterpPMA1Available SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDRFLIP36
Plasmid#65514PurposeFRET biosensor Destination vector for yeast expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-AFPt9-attR1 and attR2-Cer-cMycExpressionYeastPromoterpPMA1Available SinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEX6-2 SNAP-Syk tSH2
Plasmid#113028Purposefor purification of Syk tSh2. Purified protein will have a snap tag that can be conjugated to fluorescent dyes.DepositorInsertSNAP-Syk tSH2
TagsSNAPExpressionBacterialAvailable SinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDRFLIP43
Plasmid#65519PurposeFRET biosensor Destination vector for yeast expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-edAFPt9-attR1 and attR2-edCer-cMycExpressionYeastPromoterpPMA1Available SinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDRFLIP39
Plasmid#65517PurposeFRET biosensor Destination vector for yeast expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-edAFPt9-attR1 and attR2-t7edCFPt9-cMycExpressionYeastPromoterpPMA1Available SinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKL13-MgtC bb118
Plasmid#158982PurposeConstitutive expression (sigma 70 promoter) of mgtC protein from S. Typhimurium in E. coli.DepositorInsertmgtC
ExpressionBacterialPromoterBba_J23118 (sigma 70)Available SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCO486
Plasmid#139729PurposeModule plasmid, individual component of Fungal Bioluminescent Pathway, NpgaDepositorInsertpMOD_A_35S Short_TMV 5':AsNpga:tAtug7
UseLuciferaseExpressionPlantPromoter35SAvailable SinceMay 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-deltaR8.2(A14C,E45C,A92E)
Plasmid#79048Purposemammalian expression, lentiviral packagingDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 20, 2017AvailabilityAcademic Institutions and Nonprofits only