We narrowed to 2,963 results for: PHI-1
-
Plasmid#201249Purposeallows the expression of the insert in Drosophila melanogasterDepositorInsertɑ-Synuclein (SNCA Human)
ExpressionInsectAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRB133.2
Plasmid#181950PurposeaTc-inducible expression of PhoP with C-terminal mNeonGreen fusion. Also contains mCherry under PhoP-controlled promoter PvirKDepositorInsertPhoP-Salmonella enterica subsp. enterica serovar Typhimurium (AX04_RS23485 Synthetic, PhoP-Salmonella enterica subsp. enterica serovar Typhimurium)
TagsmNeonGreenExpressionBacterialPromoterPhoP-mNG-PLtetO-1; mCherry-PvirK; tetR-J23106Available SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-GST-DmNanos_50-236_AC
Plasmid#148465PurposeInsect Expression of DmNanos_50-236DepositorInsertDmNanos_50-236 (nos Fly)
ExpressionInsectMutationone non silent mutation D121G compared to the seq…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMTV neu NT
Plasmid#1823DepositorInsertneu NT (Erbb2 Rat)
ExpressionMammalianAvailable SinceJuly 18, 2005AvailabilityAcademic Institutions and Nonprofits only -
pUB-cSypHer
Plasmid#84733PurposeExpresses SypHer in plant cells-biosensor for pHDepositorInsertSypHer
ExpressionPlantPromoterubiqutin- 10 gene promoter (pUBQ10) of ArabidopsisAvailable SinceJuly 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
nos-Cas9.874Z1
Plasmid#112685PurposeExpress hSpCas9 under nanos promoterDepositorInserthSpCas9
Tags3x FLAG, EGFP, and NLSExpressionInsectMutationHumanized Cas9 bacterial sequencePromoternanosAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ubiq-Cas9.874W
Plasmid#112686PurposeExpress hSpCas9 under Ubiquitin-63E promoterDepositorInserthSpCas9
Tags3x FLAG, EGFP, and NLSExpressionInsectMutationHumanized Cas9 bacterial sequencePromoterUbiquitin-63E promoterAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUB-cHyPer2
Plasmid#84728PurposeExpresses HyPer2 in plant cells-biosensor for Hydrogen peroxideDepositorInsertHyPer2
ExpressionPlantPromoterubiqutin- 10 gene promoter (pUBQ10) of ArabidopsisAvailable SinceJune 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
vas-Cas9.874Z
Plasmid#112687PurposeExpress hSpCas9 under vasa promoterDepositorInserthSpCas9
Tags3x FLAG, EGFP, and NLSExpressionInsectMutationHumanized Cas9 bacterial sequencePromotervasaAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGem-nHyPer2:sHyper2
Plasmid#84737PurposeSimultaneous expresion of nuclear and stromal HyPer2 in plant cellsDepositorInsertHyPer2 targeted to nucleus
TagsNLS-SV40ExpressionPlantPromoterpFMV/p35SAvailable SinceJuly 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZA13
Plasmid#158491PurposeEntry clone for Golden Gate assembly. Golden gate compatible N. benthamiana ZAR1 without STOP codonDepositorInsertZAR1
UseGolden gate entry vectorMutationno STOP codonAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJFRC7-JEDI-1P
Plasmid#202618PurposeGenetically encoded voltage indicator (GEVI) JEDI-1P under the promoter hsp70 for Drosophila (insect) expressionDepositorInsertJEDI-1P
ExpressionInsectPromoterhsp70Available SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZA5
Plasmid#158483PurposeEntry clone for Golden Gate assembly. Golden gate compatible N. benthamiana ZAR1 with STOP codonDepositorInsertZAR1
UseGolden gate entry vectorMutationSTOP codonAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR_spatzle-HA
Plasmid#240227PurposeGateway entry clone with spatzle tagged with HA (contains stop codon)DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Nbr_C_sgRNA1
Plasmid#186663PurposeNbr C-tag sgRNA1 plasmidDepositorInsertNbr sgRNA 1 Plasmid (Nbr Fly)
ExpressionInsectAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
p28-2iDP-puro
Plasmid#88893PurposeDual-intron DMD platform plasmid. Co-expresses DMD platform segment, firefly luciferase, puroR and mCherry. Plasmid carries phiC31 and Bxb1 attB sites.DepositorInsertsDual-intron DMD platform
luciferase
puromycin resistance enzyme
mCherry
ExpressionMammalianMutationTruncated version of the dystrophin protein (tran…Available SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pEB2-mNeptune2.5
Plasmid#104013PurposePlasmid encoding mNeptune2.5DepositorInsertmNeptune2.5
UseLow copyExpressionBacterialMutationMutations relative to eqFP578 (MSKGEE LIKENM… M11…PromoterproCAvailable SinceDec. 28, 2017AvailabilityAcademic Institutions and Nonprofits only