We narrowed to 13,851 results for: CAN
-
Plasmid#160810PurposeExpress Dox repressible shPOLE1DepositorInsertshPOLE1_1
UseLentiviralAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 - HA-KLF4 FL delta K5S
Plasmid#34594DepositorInsertKLF4 (KLF4 Human)
TagsHA tagExpressionMammalianMutationdeletion of K5S, corresponding to bases 1781 to 2…PromoterCMVAvailable SinceJan. 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
Drd1a->M71-IRES-tauGFP ACNF TV
Plasmid#105073PurposeTargeting vector: the coding sequence of M71 is replaced by the sequence encoding amino acids 1-447 of Drd1a and an IRES-tauGFP followed by ACNF cassetteDepositorUseMouse TargetingMutationDrd1a coding sequence followed by IRES-tauGFP ACNFAvailable SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBpuro - HA KLF4 FL delta K5S
Plasmid#34592DepositorInsertKLF4 (KLF4 Human)
UseRetroviralTagsHA tagExpressionMammalianMutationdeletion of K5S, corresponding to bases 1781 to 2…PromoterLTRAvailable SinceJan. 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH752-CEN-RLuc/min103maxCFLuc
Plasmid#38218DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 103 codons of the original FLuc gene we…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH751-CEN-RLuc/min53maxCFLuc
Plasmid#38217DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 53 codons of the original FLuc gene wer…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K5S-Mt344A
Plasmid#34601DepositorInsertKLF4 (KLF4 Human)
UseLuciferaseExpressionMammalianMutationThe KLF4 K5S region was mutated at the miR-344 bi…PromoterCMVAvailable SinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K5S-Mt206B
Plasmid#34600DepositorInsertKLF4 (KLF4 Human)
UseLuciferaseExpressionMammalianMutationThe KLF4 K5S region was mutated at the miR-206 bi…PromoterCMVAvailable SinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only