We narrowed to 14,508 results for: SHR;

#76308

3rd generation lentiviral gRNA plasmid targeting human PPIP5K1

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#87401

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#76952

3rd generation lentiviral gRNA plasmid targeting human TPD52L3

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#77496

3rd generation lentiviral gRNA plasmid targeting human RET

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#77498

3rd generation lentiviral gRNA plasmid targeting human RET

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#77499

3rd generation lentiviral gRNA plasmid targeting human RET

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#75622

3rd generation lentiviral gRNA plasmid targeting human WNK1

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#75623

3rd generation lentiviral gRNA plasmid targeting human WNK1

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#75624

3rd generation lentiviral gRNA plasmid targeting human WNK1

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#76185

3rd generation lentiviral gRNA plasmid targeting human RAB11FIP5

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only