We narrowed to 73,945 results for: LAS
-
Plasmid#232651Purposeexpresses CHST8 REP-to-AAA mutant in mammalian cellsDepositorInsertCHST8 (3A) (CHST8 Human)
UseLentiviralTagsFlagExpressionMammalianMutationR258A, E259A, P260APromoterCMVAvailable SinceMarch 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBbA2C_Ptet::lasI
Plasmid#189576PurposeLas synthase (3OC12-HSL)DepositorInsertAcyl-homoserine-lactone synthase
UseSynthetic BiologyExpressionBacterialAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28-Butelase
Plasmid#221848PurposeExpresses asparaginyl endopeptidase butelaseDepositorInsertButelase 1 ligase
ExpressionBacterialMutationNoAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Noodles Plasmid
Plasmid#212613PurposeAn all-in-one system for on-target efficiency analysis of CRISPR guide RNAsDepositorTypeEmpty backboneUseCRISPR and LuciferaseExpressionMammalianAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Silene_conica _PheRS_PlastidTP_pK7FWG2
Plasmid#202660PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from organellar Silene conica PheRS predicted to be targeted to plastid
TagsGreen Florescent ProtienExpressionPlantAvailable SinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Lenti_EGFP-P2A_truncHaus6_IRES_Blast
Plasmid#182885PurposeTransfer vector for production of lentivirus. Control plasmid for rescue experiment of HAUS6 depletion phenotype, containing a nonsense mutation and a truncation in HAUS6.DepositorInsertHAUS 6 (HAUS6 Human)
UseLentiviralExpressionBacterial and MammalianMutationstop codon introduced 2 amino acids downstream of…PromoterEF1alpha coreAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2343_Tier3(SB)-YPet_Blast
Plasmid#169641PurposeTier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a YPet marker and BlastR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-YPet-p2A-BlastR-pA-3'ITR)DepositorInsertPRPBSA-driven YPet and BlastR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2344_Tier3(SB)-mRuby2_Blast
Plasmid#169642PurposeTier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a mRuby marker and BlastR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-mRuby2-p2A-BlastR-pA-3'ITR)DepositorInsertPRPBSA-driven mRuby2 and BlastR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2357_Tier3(PB)-TagBFP_BlastR
Plasmid#169656PurposeTier-3 vector for stable stable integration of up to three cassettes via Piggy Bac transposase including a mTagBFP2 marker and BlastR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-mTagBFP2-p2A-BlastR-pA-3'ITR)DepositorInsertPRPBSA-driven mTagBFP2 and BlastR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_KRAB-MeCP2_Blasto
Plasmid#167896PurposePiggyBac compatible plasmid expressing dCas9-KRAB-MeCP2 expression plasmidDepositorInsertdCas9-KRAB-MeCP2
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.Ollas.V5_mCherry-NLS
Plasmid#178280PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNWS.Ollas.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.NWS.Ollas_mCherry-NLS
Plasmid#178272PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.NWS.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.Ollas.V5_mCherry-NLS
Plasmid#178268PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.Ollas.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.Ollas.VSVg_mCherry-NLS
Plasmid#178267PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.Ollas.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.Ollas.S_mCherry-NLS
Plasmid#178266PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.Ollas.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.Ollas.V5_mCherry-NLS
Plasmid#178254PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.Ollas.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.Ollas.VSVg_mCherry-NLS
Plasmid#178253PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.Ollas.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.Ollas.S_mCherry-NLS
Plasmid#178252PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.Ollas.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.NWS.Ollas_mCherry-NLS
Plasmid#178248PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.NWS.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only