We narrowed to 14,127 results for: CAN
-
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBpuro - HA KLF4 FL delta K5S
Plasmid#34592DepositorInsertKLF4 (KLF4 Human)
UseRetroviralTagsHA tagExpressionMammalianMutationdeletion of K5S, corresponding to bases 1781 to 2…PromoterLTRAvailable SinceJan. 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH752-CEN-RLuc/min103maxCFLuc
Plasmid#38218DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 103 codons of the original FLuc gene we…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH751-CEN-RLuc/min53maxCFLuc
Plasmid#38217DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 53 codons of the original FLuc gene wer…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K5S-Mt344A
Plasmid#34601DepositorInsertKLF4 (KLF4 Human)
UseLuciferaseExpressionMammalianMutationThe KLF4 K5S region was mutated at the miR-344 bi…PromoterCMVAvailable SinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K5S-Mt206B
Plasmid#34600DepositorInsertKLF4 (KLF4 Human)
UseLuciferaseExpressionMammalianMutationThe KLF4 K5S region was mutated at the miR-206 bi…PromoterCMVAvailable SinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEN243-KH217
Plasmid#224550PurposeCas9-2A-puro and sgRNA targeting the STOP codon mouse Car2DepositorInsertCas9 and sgRNA targeting the STOP codon of mouse CAR2 (Car2 Mouse)
UseCRISPRExpressionMammalianAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-PE SpG_ATH51
Plasmid#242072PurposeExpresses SpG_ATH51 prime editor and pegRNA in mammalian cellsDepositorInsertSpG_ATH51_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsbpSV40 NLSExpressionMammalianMutationectopic insertion of 7 amino acids of PID turn-he…Available SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-PE iSM_PPL2
Plasmid#235996PurposeExpresses iSM_PPL2 prime editor and pegRNA in mammalian cellsDepositorInsertiSM_PPL2_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsbpSV40 NLSExpressionMammalianMutationreplacement of 5 amino acids of Smac-Cas9 PL2 wit…Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only