We narrowed to 3,248 results for: cat.3
-
Plasmid#202450Purposea seed-matched control for pRSITEP-puro-shBIRC6-2DepositorAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pGGG-AH-VRT-A2
Plasmid#163703PurposeWheat transformation vector pGoldenGreenGate (pGGG) with OsActinP:: hygromycin (hpt) selection and the full native Triticum polonicum VRT-A2 gene (native prom::genomic seq::3'UTR)DepositorInsertsOs Actin promoter :: Hygromycin resistance gene (hpt) containing CAT1 intron :: NosTerminator
Triticum polonicum VRT-A2 genomic sequence (Native promoter:: genomic sequence::3'UTR) + Nos Terminator
ExpressionPlantPromoterRice - Os Actin promoter and Triticum polonicum V…Available SinceJan. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BCL11B-E1(14))-PGKpuro2ABFP-W
Plasmid#208554PurposeLentiviral vector expressing gRNA targeting human BCL11B-E1DepositorInsertBCL11B-E1(14) (BCL11B Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
mRFP-FKBP-INPP5E(D556A)
Plasmid#183678PurposeRecruitable human type IV 5-phosphatase enzyme (catalytically inactive)DepositorInsertINPP5E (INPP5E Human)
TagsmRFP-FKBP12(1-108)ExpressionMammalianMutationC641A, D556APromoterCMVAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pABD1275
Plasmid#68017PurposePIF1 protein overproduction for purification from bacterial cellsDepositorInsertPHY-INTERACTING FACTOR 1 (PIF1) (PIL5 AT2G20180, Mustard Weed)
Tags6x-HisExpressionBacterialMutationCodon Optimized for bacterial expression (GenScri…PromoterT7Available SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BCL11B-E1(13))-PGKpuro2ABFP-W
Plasmid#212116PurposeLentiviral vector expressing gRNA targeting human BCL11B-E1DepositorInsertBCL11B-E1(13) (BCL11B Human)
UseLentiviralAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-S580X
Plasmid#195474PurposepInducer21 plasmid containing the human MEFV gene with the S580X mutation (stop codon leading to the truncation of the B30.2 domain of the pyrin protein) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationchanged S580 to a stop codonAvailable SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
p3E-SGTAP no-pA
Plasmid#82599Purpose3' entry vector containing streptavidin binding protein (SBP) followed by a TEV cleavage site and 2 protein G copies without pA for tandem affinity purificationDepositorInsertSBP-TEV-2x protein G
PromoterNoneAvailable SinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJFRC7-JEDI-1P
Plasmid#202618PurposeGenetically encoded voltage indicator (GEVI) JEDI-1P under the promoter hsp70 for Drosophila (insect) expressionDepositorInsertJEDI-1P
ExpressionInsectPromoterhsp70Available SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28 MBP-TEV-Rat BCKDK-His
Plasmid#232119PurposeFor bacterial expression of His-tagged Rat BCKDK (AA31-412, missing precursor peptide) with a cleavable MBP purification tag.DepositorInsertBCKDK (Bckdk Rat)
Tags6 x His, Maltose-Binding Protein (MBP), and Tev S…ExpressionBacterialPromoterT7 PromoterAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBN33
Plasmid#35132DepositorInsertfcy1-natMX4
UseYeast replicatingAvailable SinceAug. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
pIC80
Plasmid#63064PurposeMammalian expression of EGFP-TEV-S-tag DSN1 for protein localization and affinity purification (LAP)DepositorAvailable SinceJan. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/HA-SUMO3 (Sentrin 2)
Plasmid#17361PurposeMammalian expression of human SUMO3 with HA tagDepositorAvailable SinceApril 4, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-TO-Puromycin-mVenus-MAP
Plasmid#44118DepositorTypeEmpty backboneTagsmVenus-MAPExpressionMammalianAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-TO-Hygromycin-sfGFP-MAP
Plasmid#44100DepositorTypeEmpty backboneTagssfGFP-MAPExpressionMammalianAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-TO-Hygromycin-mVenus-MAP
Plasmid#44099DepositorTypeEmpty backboneTagsmVenus-MAPExpressionMammalianAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEGFPN3-Sstr3
Plasmid#35623DepositorAvailable SinceMarch 30, 2012AvailabilityAcademic Institutions and Nonprofits only