We narrowed to 3,006 results for: 2-Oct
-
Plasmid#91626PurposeExpress sgRNA targeting human HCN1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pCGN-HCF-1-N1011Δ382-450
Plasmid#92322PurposeN-term of HCF-1 protein without amino acids 382-450DepositorInsertHCF-1 (HCFC1 Human)
TagsHAExpressionMammalianMutationAA 2-1011 with internal deletion Δ382-450PromoterCMVAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_SLA2-1/1
Plasmid#91450PurposeProtein expression and purification of human SH3 domain construct SLA2-1/1DepositorInsertSLA2-1/1 (SLA2 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pME18S-3HA-mULK2(K39T)
Plasmid#22899DepositorInsertUNC-51-like kinase 2 (Ulk2 Mouse)
Tags3xHAExpressionMammalianMutationchanged Lysine 39 to ThreonineAvailable SinceSept. 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/HisMaxB-YAP2-1st WW mutant
Plasmid#18998DepositorInsertYes-kinase associated protein (YAP1 Human)
TagsHisExpressionMammalianMutationTryptophan 199 changed to Alanine, and Proline 2…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/HisMaxB-YAP2-2nd WW mutant
Plasmid#18999DepositorInsertYes-kinase associated protein (YAP1 Human)
TagsHisExpressionMammalianMutationTryptophan 258 changed to Alanine, and Proline 2…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
pSP64-hERG1a F656A
Plasmid#53054PurposeExpresses alpha subunit of F656A hERG1a K channel in Xenopus oocytesDepositorInsertPotassium voltage-gated channel subfamily H member 2 (KCNH2 Human)
UseXenopus oocyte expressionMutationchanged Phenylalanine 656 to AlaninePromoterSP6Available SinceJune 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSP64-hERG1a Y652A
Plasmid#53053PurposeExpresses alpha subunit of Y652A hERG1a K channel in Xenopus oocytesDepositorInsertPotassium voltage-gated channel subfamily H member 2 (KCNH2 Human)
UseXenopus oocyte expressionMutationchanged Tyrosine 652 to AlaninePromoterSP6Available SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPN060
Plasmid#91593PurposeExpress sgRNA targeting human CYP26B1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN061
Plasmid#91594PurposeExpress sgRNA targeting human CYP26B1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETDuet::dddA11-MBP/dddI
Plasmid#248876PurposeExpression of DddA11-MBP and its immunity protein in bacterial cells for protein purificationDepositorInsert6His-DddA11-TEV-GSlinker-MBP, DddI
ExpressionBacterialAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUGW-EGFP-mPkm2
Plasmid#242812PurposeLentiviral vector expressing mouse Pkm2 tagged with an N-terminal EGFPDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D-Lck-mCherry-ibARK
Plasmid#241241PurposeExpression of plasma membrane-tethered ibARK in astrocytesDepositorInsertLck-mCherry-ibARK
UseAAVAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
hSyn1-mCherry-CAAX
Plasmid#223674PurposeAAV expression of mCherry from hSyn1 promoterDepositorInsertmCherry-CAAX
UseAAVPromoterhSyn1Available SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-AMLn-CAGEn-NES (Nrdj1)
Plasmid#241408PurposeProximity-triggered Protein Trans-Splicing to generate the splice product AML1-ETO, Figure 2 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-NUP98n-CAGEn-NES (Nrdj1)
Plasmid#241418PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Figure 2 & Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pShuttle.Cre
Plasmid#192930PurposeGateway compatible vector with BsaI cloning site and Cre expressionDepositorTypeEmpty backboneUseGateway-compatible cloning vectorPromoterCMVAvailable SinceDec. 9, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
-
mutpRL-TK 2xUTR
Plasmid#40757PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsert2 copies of the CXCR4 small RNA target site
UseLuciferaseTagsluciferaseMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable SinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only