We narrowed to 25,116 results for: promoter
-
Plasmid#38238DepositorUseLuciferaseExpressionMammalianMutationActb promoter (1000 nt upstream) and 5' UTR …PromoterEndogenous VimAvailable SinceNov. 7, 2012AvailabilityAcademic Institutions and Nonprofits only
-
p8327 pLIX YAP1 S127A
Plasmid#184528PurposeExpression of YAP1 S127ADepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVXCMV100-mNeonGreen-PBD
Plasmid#241366PurposeLentiviral expression of mNeonGreen-tagged PAK1 p21-binding domain (PBD)DepositorInsertPak1 fragment (PAK1 Human)
UseLentiviralTagsmNeonGreenMutationaa 57-141PromoterTruncated CMV promoterAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRR-AR
Plasmid#73045PurposeConstitutively expresses the androgen receptor, which is required for the activation of the promoter in pLAREG (Addgene plasmid #73045)DepositorInsertAndrogen receptor (AR Human)
ExpressionYeastMutationplease see depositor comments belowPromoterglyceraldehyde phosphate dehydrogenase (GPD)Available SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNW538_pAAVS1-pAP1(2)-FlpO-ABI-P2A-PYL-FlpO-CAG-U1-frt-STOP-frt-U2-GFP-P2A-luc2-ZeoR
Plasmid#192939PurposeFlpO-based digitizer circuit driven by AP1 promoterDepositorInsertsAP1(2)/minTK promoter
FlpO-ABI
PYL-FlpO
CAG promoter
frt-STOP-frt
GFP
luciferase
pPGK
Zeocin resistance
BFP
UseSynthetic BiologyExpressionMammalianAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hADM-RFP
Plasmid#22922DepositorAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
phTERT-cp PS Intein tTA
Plasmid#242032PurposeBlue-light-controlled, hTERT-promoter-driven release of the tTA transactivator from cytoplasm to nucleus.DepositorInsertCp PS Intein tTA
ExpressionMammalianMutationThe CMV promoter was replaced with the hTERT prom…PromoterhTERTAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-P41nmt1-GFP
Plasmid#39290DepositorInsertnmt1 promoter (nmt1 Fission Yeast)
UseYeast genomic targetingTagsA. gossypii translation elongation factor 1a gene…Mutation-1163 to +6 of nmt1 locus with a 4bp deletion (TA…Available SinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
LV-Let7d-5p
Plasmid#117055PurposeOverexpression of Let-7d-5p using miR-451 backbone to enable DICER independent expression along with orange fluorescent protein (OFP) to track miRNA expressionDepositorInsertLet-7d-5p - OFP
UseLentiviralPromoterSFFV promoterAvailable SinceOct. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-P81nmt1-GFP
Plasmid#39291DepositorInsertnmt1 promoter (nmt1 Fission Yeast)
UseYeast genomic targetingTagsA. gossypii translation elongation factor 1a gene…Mutation-1163 to +6 of nmt1 locus with a 7bp deletion (AT…Available SinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mCamk2a-EGFP
Plasmid#153197PurposeMouse Camk2a (mCamk2a) promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
p8328 pLIX YAP1 S94A
Plasmid#184529PurposeExpression of YAP1 S94ADepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-P41nmt-3HA
Plasmid#39284DepositorInsertnmt1 promoter (nmt1 Fission Yeast)
UseYeast genomic targetingTags3xHA, A. gossypii translation elongation factor 1…Mutation-1163 to +6 of nmt1 locus with a 4bp deletion (TA…Available SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pKM50
Plasmid#123656PurposeEncodes Renilla luciferase under the Aedes aegypti ubiquitin UbL40 promoter for constitutive expression in mosquito cellsDepositorInsertAedes aegypti UbL40 promoter
UseLuciferaseExpressionInsectPromoterUbL40 promoterAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-P81nmt1-3HA
Plasmid#39285DepositorInsertnmt1 promoter (nmt1 Fission Yeast)
UseYeast genomic targetingTags3xHA, A. gossypii translation elongation factor 1…Mutation-1163 to +6 of nmt1 locus with a 7bp deletion (AT…Available SinceAug. 14, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-CAG-EGFP
Plasmid#153186PurposeCAG promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CaMKIIa_SERT_EYFP
Plasmid#198737PurposeSerotonin transporter with EYFP fluorescent protein driven by CaMKIIa promoter on a AAV vectorDepositorInsertSerotonin transporter and yellow fluorescent protein
UseAAVExpressionMammalianPromoterCaMKIIaAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_version2_U6_AtPDS3_gRNA10
Plasmid#197952PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter, with SV40 NLS at the C-terminal , and the AtPDS3 guide RNA 10 driven by U6 promoter.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterAtU6-26 and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKnockinDonor-humanCTCF-miniAID-mClover3
Plasmid#136883Purposeknockin donor vector of miniAID-mClover3 to C-terminus of endogenous human CTCFDepositorInsertCTCF-knockin-homology arm-miniAID-mClover3
TagsminiAID-mClover3ExpressionMammalianPromoterno promoterAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only