We narrowed to 2,364 results for: 1186
-
Plasmid#1186DepositorAvailable SinceMay 25, 2005AvailabilityAcademic Institutions and Nonprofits only
These results may also be relevant.
-
P2_DD-HNF4A8
Plasmid#31095DepositorInsertHNF4A (HNF4A Human)
UseFlp/frtTagsFKBP L106P and mycExpressionMammalianMutationsplice variant 8 derived from promoter P2Available SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCMV-FLAG-CRY2-STIM1(238-685)
Plasmid#248293PurposeAn expression construct encoding a CRY2-fused FLAG-tagged STIM1 fragment (a.a.238–685).DepositorInsertCRY2-fused FLAG-tagged STIM1 fragment (a.a.238–685) (STIM1 )
TagsFLAGMutationdeleted amino acids 1-237PromoterCMVAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV-CIBN-STIM1(238-685)
Plasmid#248296PurposeAn expression construct encoding a CIBN-fused STIM1 fragment (a.a.238-685).DepositorInsertCIBN-fused STIM1 fragment (a.a.238-685) (STIM1 Human)
TagsCIBNExpressionMammalianMutationdeleted amino acids 1-237PromoterCMVAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV-EGFP-CRY2-STIM1(318-450)
Plasmid#248294PurposeAn expression construct encoding a CRY2-fused truncated STIM1 fragment (a.a.318–450).DepositorInsertCRY2-fused truncated STIM1 fragment (a.a.318–450) (STIM1 )
TagsEGFPMutationdeleted amino acids 1-317,451-685PromoterCMVAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-TDP-43 (PY-NLS)
Plasmid#235490PurposeExpression of chimeric human TDP-43-EGFP bearing a PY-nuclear localization sequence (NLS) from HNRNPA1 in place of the native NLS sequenceDepositorInsertTARDBP (TARDBP Human)
TagsEGFPExpressionMammalianMutationReplaced native NLS with PY-NLS from HNRNPAAvailable SinceMay 19, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
PX459v3-eSpCas9(1.1)
Plasmid#178800PurposeHigh-fidelity eSpCas9(1.1) with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX459v3-SpCas9-HF1
Plasmid#178801PurposeHigh-fidelity SpCas9-HF1 with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1663 - pAAV SYN1 mGas6-Myc-DDK
Plasmid#202540PurposeAn adeno-associated viral vector expressing murine Gas6 fused Myc and DDK epitopes from a synapsin promoterDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
SITS-EGFP-Bin1b
Plasmid#176021PurposeLeishmania cell free expression of zebrafish EGFP-Bin1b. Parton lab clone GRSDepositorAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_2] (GB1209)
Plasmid#75410PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_2]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (3-part multiplexing)DepositorInserttRNA-gRNA position [M1_2]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/T646A
Plasmid#74937PurposeMammalian expression of human NSF mutant T646A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
TagsFLAGExpressionMammalianMutationT646A (mutation in the D2 domain of the protein)PromoterCMVAvailable SinceApril 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/T645A
Plasmid#74936PurposeMammalian expression of human NSF mutant T645A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
TagsFLAGExpressionMammalianMutationT645A (mutation in the D2 domain of the protein)PromoterCMVAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLX_TRC311/NLS-Cas13d-P2A-Blast
Plasmid#212196PurposeCasRx (NLS-RfxCas13d-NLS) with 2A-Blasticidin for RNA targeting. CasRx-2A-Blasticidin is driven by EF1a promoter. EGFP is driven by SV40DepositorInsertCasRx (NLS-RfxCas13d-NLS)-HA with 2A-Blasticidin
UseCRISPR and LentiviralTagsHA, NLS, and blasticidin S deaminaseExpressionMammalianPromoterEF-1α promoterAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 hMOG-alpha1-EGFP
Plasmid#126463PurposeExpression a human MOG (isoform alpha1) EGFP fusion protein in mammalian cellsDepositorAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL3-RANGAP.C-linker.miniIAA7.3xFlag.P2A.BSD
Plasmid#216248PurposeHDR template to tag endogenous human RANGAP1 C-terminus with miniIAA7.3xFlag.P2A.BSDDepositorInsertHDR template for human RANGAP1 (RANGAP1 Human)
UseCRISPR and TALEN; Hdr templateTagsminiIAA7.3xFlag.P2A.BSDExpressionMammalianAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHEE401
Plasmid#71286PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertssgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 promoter and U6-26p Arabidopsis U6 gene pro…Available SinceJan. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-SEC61B.N-BSD.P2A.miniIAA7.3xFlag
Plasmid#216250PurposeHDR template to tag endogenous human SEC61B N-terminus with BSD.P2A.miniIAA7.3xFlagDepositorInsertHDR template for human SEC61B (SEC61B HDR template, Synthetic, Human)
UseCRISPR; Hdr templateTagsBSD.P2A.miniIAA7.3xFlagExpressionMammalianAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSC-LHX8-IRES-GBX1
Plasmid#182235PurposeTo convert human skin fibroblasts into induced basal forebrain cholinergic neurons (hiBFCNs) in combination with ASCL1, Sox11, FGF2 and two small molecules, forskolin and LDN-193189DepositorAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only