We narrowed to 4,510 results for: pes
-
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROP-seq-copGFP-v2-no-scaffold
Plasmid#228520PurposeCROP-seq-puro-v2 with scaffold sequence removed for the insertion of CRISPRmap Opool with guide, scaffold and barcode sequences, using copGFP as selection markerDepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-FLAG-Regnase-3-HA_full-length
Plasmid#222656PurposeMammalian expression vector to express full-length Regnase-3 tagged with FLAG at N-term and HA at C-termDepositorAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57 mini-FLAG-HA-Regnase-3 WT
Plasmid#222651PurposeFor in vitro transcription of mouse Zc3h12c tagged with FLAG-HA at N-termDepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBS-KDRT-STOP-loxP-3XP3::dsRed-loxP-STOP-KDRT-1XALFA
Plasmid#217509PurposeKD Recombinase dependent conditional 1X ALFA cassetteDepositorInsertKDRT-STOP-loxP-3XP3::dsRed-loxP-STOP-KDRT-1XALFA
TagsALFA tagExpressionInsectAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_MSX1-FKBP-mNeonGreen-V5
Plasmid#215025PurposeAAV vector for knocking in a C-terminal tag (FKBP12F36V, mNeonGreen, and V5) for human MSX1DepositorAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCas-mut4/1_2_VB
Plasmid#186444PurposeEncodes Cas4(K81A)/1, Cas2, leader, repeat and one spacer from A. acidoterrestris (type V-B)DepositorInsertCas4/1 and Cas2
UseCRISPRMutationCas4 domain (K81A)PromoterT7Available SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT22gCfpUbiG4FER4P2A(#249)
Plasmid#184070Purposecyclofen-inducible GAL4 activation in zebrafish permanent transgenicDepositorInsertGal4bdFF-ERT2-P2A
UseZebrafish transgenesis (blue eyes)MutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only