We narrowed to 17,211 results for: IGH@;
-
Plasmid#46617DepositorAvailable SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only
-
SpCas9-HF1
Plasmid#138556PurposeExpresses human codon-optimized high-fidelity SpCas9 and blasticidin resistance: EFS promoter-SpCas9-HF1-NLS-FLAG-P2A-BSDDepositorInsertSpCas9-HF1
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926APromoterEFSAvailable SinceJune 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EFS-foldon-GFP- PCP
Plasmid#194503PurposeExpression foldon-GFP-PCP protein for imaging of nonrepetitive DNADepositorInsertfoldon-GFP-PCP
UseLentiviralExpressionMammalianPromoterEF-1α core promoterAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
FRB-mCherry-FTH1
Plasmid#100749PurposePart of FerriTag expression system. Encodes human Ferritin with an FRB domain and mCherry tagDepositorAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
H2B-mGreenLantern
Plasmid#164464PurposeLocalization of mGreenLantern fluorescent protein to histone 2BDepositorInsertmGreenLantern
TagsHuman Histone 2B (D26G and V119I mutations)ExpressionMammalianMutationClover-F64L/S72A/E124V/N149K/I167T/S175G/A206K/L2…PromoterCMVAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMVS102_P3-GFP-NATMX6
Plasmid#99048PurposeEGFP reporter with six binding sites for the Zif268 DNA binding domainDepositorInsertsMcIsaac 2014 P3 promoter
eGFP
clonNAT resistance
ExpressionYeastMutationGAL1 promoter with 4 GAL4 sites removed and repla…PromoterMcIsaac 2014 P3 promoterAvailable SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131-STU-Lb
Plasmid#138096PurposeGolden Gate entry vector for 1st crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134-STU-Lb
Plasmid#138105PurposeGolden Gate entry vector for 4th crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133-STU-Lb
Plasmid#138102PurposeGolden Gate entry vector for 3rd crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only