168,035 results

#221319

Dox-inducible expression of IRSp53 mutant in mammalian cells by retroviral transduction

Jonathan Kagan

Landau et al Mol Cell. 2024 Jul 11;84(13):2436-2454.e

July 16, 2024

Academic Institutions and Nonprofits only

#213771

Fluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.

Gaetano Gargiulo

Company et al Nat Commun. 2024 Feb 5;15(1):897. doi: 1

March 21, 2024

Academic Institutions and Nonprofits only

#211692

U6-sgRNA-EFS-Cas9-P2A-mNeonGreen

Christof Fellmann

Tan et al Cell Rep. 2023 Nov 28;42(11):113339. doi

Feb. 1, 2024

Academic Institutions and Nonprofits only

#208688

Expresses the genetically-encoded fluorescent norepinephrine (NE) sensor GRAB_NE2m pan-neuronally in zebrafish

Yulong Li

Feng et al Neuron. 2024 Jun 19;112(12):1930-1942.e6

Oct. 25, 2023

Academic Institutions and Nonprofits only

#144573

Lentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.

Feng Zhang

Joung et al Cell. 2023 Jan 5;186(1):209-229.e26. doi

Aug. 14, 2023

Academic Institutions and Nonprofits only

#129348

Halo Tag, Mitochondrial outer membrane localization

Yasushi Okada

Wang et al Proc Natl Acad Sci U S A. 2019 Aug 6;116

April 28, 2022

Academic Institutions and Nonprofits only

#177044

MoClo Level 1, position 3, transcriptional unit for transient expression of geraniol synthase (CrGES) from Catharanthus roseus driven by 35S promoter; contains a chloroplast transit peptide

Nicola Patron

Dudley et al Commun Biol. 2022 Sep 10;5(1):949. doi:

Nov. 30, 2021

Academic Institutions and Nonprofits only

#177020

Level 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTT

Nicola Patron

Dudley et al Commun Biol. 2022 Sep 10;5(1):949. doi:

Nov. 19, 2021

Academic Institutions and Nonprofits only

#127776

Modified pTK plasmid containing chicken EdnrB E2 enhancer driving expression of full length Chicken Tfap2B in frame with an Avi tag at the N terminus and FLAG-tag and Citrine at the C-terminus

Tatjana Sauka-Spengler

Ling et al Nat Cell Biol. 2019 Dec;21(12):1504-1517

Jan. 13, 2020

Academic Institutions and Nonprofits only

#117157

Target site TATTTCCCTGTCTCCTTGGCC

Jeremy Luban

McCauley et al Nat Commun. 2018 Dec 13;9(1):5305. doi:

March 14, 2019

Academic Institutions and Nonprofits only