We narrowed to 5,812 results for: 129
-
Plasmid#140829PurposeAIMTOR BRET Biosensor containing a mutated non-phosphorylable ULK1 peptide to use as a control constuct in parrallel with AIMTOR T757DepositorInsertAIMTOR A757 (ULK1 Human)
TagsNES Nuclear export signalExpressionMammalianMutationThe insert comprises only a small sequence of hum…Available SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCF806-shABC2
Plasmid#186714PurposeExpresses dox-controlled miR-E shRNAs (UT4GEPIR). Multi-miR shRNAs targeting A-RAF, B-RAF, and C-RAF (shABC2 = shARAF.169-shBRAF.1296-shCRAF.387). The shABC2 set is better than shABC1.DepositorAvailable SinceJan. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
Ac5-STABLE2-RFP-NLS-CycB(1-266)_GFP-E2F1(1-230)_neo
Plasmid#73164Purposemulti-cistronic Vector for expression for Fly_FUCCI probes in insect cellsDepositorTagsmRFP1, GFPExpressionInsectMutationCyclin B Fragment aa 1-266 & E2F1 Fragment aa…Available SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAd-PRL.Cre
Plasmid#192937PurposeAdenoviral expression vector encoding sgRNAs targeting Trp53, Rb1 and Rbl2 and CreDepositorUseAdenoviralExpressionMammalianPromoterU6Available SinceDec. 9, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
AIMTOR T757
Plasmid#140828PurposeAIMTOR T757 contains a cytoplasmic mTOR Activity Reporter derived from hu ULK1 protein boxed between BRET-compatible entities (Ypet and Nanoluciferase) to measure mTOR activity in living cellsDepositorInsertAIMTOR T757 (ULK1 Human)
TagsNES Nuclear export signalExpressionMammalianMutationThe insert comprises only a small sequence of hum…Available SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUltra-MDH1-ME1
Plasmid#184465PurposeLentiviral vector for tri-cistronic expression of EGFP, MDH1 and ME1 (seperated by P2A and T2A)DepositorUseLentiviralTagsfused to T2AExpressionMammalianMutationdeletion of stop codonPromoterUbCAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-D1-IRES-SS-D2-IRES-HA-D3
Plasmid#215119PurposeExpresses FLAG-Cyclin D1, SS-Cyclin D2 and HA-Cyclin D3 in mammalian cells from an inducible lentiviral vector.DepositorUseLentiviralTagsFLAG-tag, HA-tag, and SS (STREP-STREP)ExpressionMammalianPromoterIRES and TREG3Available SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEMS1600
Plasmid#29274PurposePleiades (Ple) MiniPromoter expression pattern described in Portales-Casamar et al., PNAS, 2010 (PMID: 20807748).Pleiades (Ple) MiniPromoter expression pattern described in Portales-Casamar et al., PNDepositorInsertPle129 (MKI67 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 4, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBiT3.1-N_WDR62:1-1518
Plasmid#211257PurposeMammalian expression of full-length human WDR62 isoform 4. N-terminal HiBiT tag.DepositorInsertWDR62:M1-H1518 (WDR62 Human)
TagsMVSGWRLFKKISGSSGGSSGExpressionMammalianMutationisoform 4. L850S natural VAR_031299. Q1305L n…PromoterCMVAvailable SinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFBOH-MHL_WDR54:1-334
Plasmid#210931PurposeInsect expression of full-length human WDR54. N-terminal 6X His tag with TEV cleavage.DepositorInsertWDR54:M1-V334 (WDR54 Human)
TagsMHHHHHHSSGRENLYFQGExpressionInsectMutationwild typePromoterPolyhedrinAvailable SinceMarch 20, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBiT3.1-N_DNAI4:1-848
Plasmid#211258PurposeMammalian expression of full-length human DNAI4. N-terminal HiBiT tag.DepositorInsertDNAI4:M1-A848 (WDR78 Human)
TagsMVSGWRLFKKISGSSGGSSGExpressionMammalianMutationG16A natural variant VAR_057635. C33W natural v…PromoterCMVAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only