We narrowed to 6,905 results for: crispr cas9 plasmids
-
Plasmid#69230PurposeExpresses R1335K mutant SpCas9 fused to ZFP-TS4 in mammalian cellDepositorInsertTS4 ZFP
UseCRISPRTagsNLS-3XHA-NLSExpressionMammalianMutationPromoterAvailable sinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV-AIO-M11-gRNA-EFS-NMS-SadCas9
Plasmid#210710PurposeThis Plasmid express M11 promoter driven SadCas9 specific gRNA and EFS promoter driven NMS transactivation module fused to SadCas9DepositorInsertSadCas9 specific gRNA and NMS fused to N-terminus of SadCas9
UseAAV and CRISPRTagsFLAGExpressionMammalianMutationD10A/N580APromoterM11Available sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_YES_i2
Plasmid#231419PurposeThis YES-gate plasmid expresses dCas9 from a constitutive promoter, GFP from a promoter repressible by sgRNA-Y, and sgRNA-Y repressible by sgRNA-2.DepositorInsertsdCas9
GFP
sgRNA-Y
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP774_dCas9-Spy-Snoop-Sunx5-Avi-Tag-BFP (dCas9-SSSavi-BFP)
Plasmid#211767PurposedCas9 docking array with four tag domains (Spy, Snoop, aGCN4, Avi), with BFP selectionDepositorInsertdCas9, Spy, Snoop, aGCN4, AviTags
UseTags3xHAExpressionMammalianMutationdCas9 D10A and H840APromoterpGK and pEF1aAvailable sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-GfABC1D-SaCas9-WPRE3-pA
Plasmid#203540PurposeSaCas9 expression in astrocytesDepositorInsertSaCas9
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pED9x (dCas9-KRAB-mCherry)
Plasmid#163956PurposeLentiviral expression plasmid of sgRNA with mCherryDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6 promoter for crRNA expression and EFS promoter…Available sinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-U6-sgHTT1-7sk-sgCas9
Plasmid#190900PurposeAAV-KamiCas9 vector expressing sgGFP and human HTT sgRNAsDepositorInsertsgRNA (HTT spCas9, Human)
UseAAV and CRISPRTagsExpressionMutationPromoterU6 and 7skAvailable sinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVss-U6-sgHTT51-7sk-Cas9
Plasmid#190901PurposeAAV-KamiCas9 vector expressing sgGFP and mouse HTT sgRNADepositorInsertsgRNA (Htt Mouse)
UseAAV and CRISPRTagsExpressionMutationPromoterU6 and 7skAvailable sinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only