We narrowed to 6,879 results for: crispr cas9 plasmids
-
Plasmid#210710PurposeThis Plasmid express M11 promoter driven SadCas9 specific gRNA and EFS promoter driven NMS transactivation module fused to SadCas9DepositorInsertSadCas9 specific gRNA and NMS fused to N-terminus of SadCas9
UseAAV and CRISPRTagsFLAGExpressionMammalianMutationD10A/N580APromoterM11Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_YES_i2
Plasmid#231419PurposeThis YES-gate plasmid expresses dCas9 from a constitutive promoter, GFP from a promoter repressible by sgRNA-Y, and sgRNA-Y repressible by sgRNA-2.DepositorInsertsdCas9
GFP
sgRNA-Y
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP774_dCas9-Spy-Snoop-Sunx5-Avi-Tag-BFP (dCas9-SSSavi-BFP)
Plasmid#211767PurposedCas9 docking array with four tag domains (Spy, Snoop, aGCN4, Avi), with BFP selectionDepositorInsertdCas9, Spy, Snoop, aGCN4, AviTags
Tags3xHAExpressionMammalianMutationdCas9 D10A and H840APromoterpGK and pEF1aAvailable SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.GFP
Plasmid#57827PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-eGFP
UseCRISPR and LentiviralTagsFLAGAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9.luxR(mut)-sggfp
Plasmid#236185PurposeThe plasmid pQdCas9.luxR(mut)-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the GFP gene. Additionally, this plasmid contains a mutation in the luxR gene.DepositorInsertQuorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pED9x (dCas9-KRAB-mCherry)
Plasmid#163956PurposeLentiviral expression plasmid of sgRNA with mCherryDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter for crRNA expression and EFS promoter…Available SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-U6-sgHTT1-7sk-sgCas9
Plasmid#190900PurposeAAV-KamiCas9 vector expressing sgGFP and human HTT sgRNAsDepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-GfABC1D-SaCas9-WPRE3-pA
Plasmid#203540PurposeSaCas9 expression in astrocytesDepositorInsertSaCas9
UseAAVExpressionMammalianAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only