We narrowed to 7,190 results for: gan
-
Plasmid#70614PurposeGateway ORF clone of human SPRY2 [NM_005842.2] without stop codon (for C-terminal fusions)DepositorInsertSPRY2 (SPRY2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgRNA with rpr-1 promoter
Plasmid#48961Purposeto drive the sgRNA expression under RNase P non-coding RNA promoterDepositorTypeEmpty backboneUseCRISPRExpressionWormPromoterrpr-1 promoterAvailable SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMLS234
Plasmid#73682PurposeSapTrap 3-site Destination vector for N-terminal GFP tagging with embedded Cbr-unc-119 selectable markerDepositorInsertGFP + Cbr-unc-119
UseCRISPR and Cre/LoxTagsGFPExpressionWormAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-DRE-1-pcDNA3.1-
Plasmid#52513Purposeexpresses C. elegans DRE-1 in mammalian cells with FLAG-HA tag at N-terminusDepositorAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJM614-TRA-2::GFP
Plasmid#27128DepositorInsertTRA-2 GFP (tra-2 Nematode)
TagsGFPExpressionWormMutationreplaced stop codon with AgeI and EcoRI added GFP…Available SinceJan. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPD95.77-wVenus
Plasmid#37465DepositorTypeEmpty backboneExpressionWormPromoternoneAvailable SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMDJ13 - pEXP[Peft-3 | tagRFP-T (NLS) | tbb-2 UTR]
Plasmid#159800PurposeExpression construct with ubiquitous expression to test fluorescence level on microscopeDepositorInsertpEXP[Peft-3 | tagRFP-T (NLS) | tbb-2 UTR]
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNM3649
Plasmid#154110PurposeminiMos dual component RMCE landing site vectorDepositorInsertloxP::SEC::loxP::rpl-28p::FRT::GFP::his-58::unc-54 3'::FRT3
UseMinimosPromoternot applicableAvailable SinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pClneoFH-let60 G12V
Plasmid#66860PurposeExpress FLAG-His6-tagged dominant active let60, in which Glycine 12 is mutated to Valine, in mammalian cellsDepositorInsertLet-60 (let-60 Nematode)
TagsFLAG-His6ExpressionMammalianMutationGlycine 12 is mutated to valinePromoterCMVAvailable SinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIK137
Plasmid#65632PurposeExpresses gfp::h2b in C. elegans cells from the ubiquitous eef-1A.1 (eft-3) promoter and contains a C. briggsae unc-119 rescuing fragmentDepositorInsertPeft-3::gfp::h2b::tbb-2 3'UTR, C. briggsae unc-119 rescue fragment
ExpressionWormAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGC276
Plasmid#19637DepositorInsertGateway(R1-R2)UseFlp/frt, destination vectorExpressionWormAvailable SinceMarch 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGC163
Plasmid#19635DepositorInsertGateway(R1-R2)UseFlp/frt, destination vectorExpressionWormAvailable SinceFeb. 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSK267
Plasmid#129272Purpose"ZF only" yTRAP control to control for yTRAP reporter fluorescence changes not dependent on sensed proteinDepositorInsertNLS-VP16-ZF 43-8-NES
Tags6xHAExpressionYeastPromoterSUP35Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1258
Plasmid#44478DepositorInsertMinimal Mos1, [4-3] Gateway
UseGateway CloningAvailable SinceApril 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMOD4 RT-G
Plasmid#19184DepositorInsertrpsL tetA
UseRecombineeringTags50 nucleotides of FLAG-GFPAvailable SinceJan. 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
pISH-bovine-tau
Plasmid#15864DepositorInsertbovine tau (MAPT )
Available SinceMay 6, 2008AvailabilityAcademic Institutions and Nonprofits only -
L4663
Plasmid#1665DepositorTypeEmpty backboneTagsmyo3-2341, myo3Tsa, SV40NLS, gfpN, IVSR, gfpY66W,…ExpressionWormAvailable SinceMarch 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
L4018
Plasmid#1614DepositorTypeEmpty backboneTagsIVSA, rf2204, SV40NLS, SV40NLS, SV40NLS, SV40NLS,…ExpressionWormAvailable SinceMarch 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2240 - [1-2] ENTR - Fluor - ce-tagRFP-T (1 intron, syntrons(3), no_atg, no_stop)
Plasmid#159855PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - ce-tagRFP-T (1 intron, syntrons(3), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only