We narrowed to 15,903 results for: grna
-
Plasmid#235606PurposegRNA targeting PECAM1 3' terminal for CRISPR-Cas9-mediated knock-inDepositorAvailable sinceJune 17, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLenti‐puro‐OgRNA_mdxE53
Plasmid#187054PurposeSpCas9 gRNA correcting mdx4cv nonsense mutation with ABEDepositorInsertSpCas9 gRNA correcting mdx4cv nonsense mutation with ABE
UseLentiviralExpressionMammalianPromoterU6Available sinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7ddx19gRNA
Plasmid#47932Purposein vitro transcription of ddx19 gRNADepositorInsertddx19 gRNA (ddx19 Zebrafish)
UseCRISPRAvailable sinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT22
Plasmid#223394PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for monocot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter.DepositorInsertZmUbi-hA3A-Y130F-SpRYD10A-UGI-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT19
Plasmid#223391PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter.DepositorInsertAtUBQ10-hA3A-Y130F-SpRYD10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_016-sgATF4-3
Plasmid#202456PurposeExpression of a guide RNA targeting ATF4DepositorAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
HP-Cas9hGem-Ade2-LEU2-LINEAR
Plasmid#174839PurposepRS414 backbone containing LINEAR fragment targeting ADE2 in H. polymorphaDepositorInsertHH-gRNA-HDV targetting ADE2 in Ogataea (para)polymorpha
UseCRISPR and Synthetic BiologyExpressionBacterial and YeastPromoterTDH3pAvailable sinceJan. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-VP64-pU6-sgRNA
Plasmid#158972PurposeVector C encodes pAAV-pMecp2-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in neuronsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available sinceSept. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 U6-26:gRNA 4 (Pnos):2.1 aptamer (GB1724)
Plasmid#160621PurposeTarget for the Nopaline Synthetase Promoter with the MS2 recognition 2.1 loop in position3' in the scaffoldDepositorInsertU6-26:gRNA 4 (pNos): 2.1 aptamer
UseCRISPR and Synthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterU6-26Available sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-Lrp5 gRNA
Plasmid#246548PurposeCRISPR vector co-expressing Cas9 and a mouse Lrp5 gRNADepositorAvailable sinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-Fzd5 gRNA
Plasmid#246564PurposeCRISPR vector co-expressing Cas9 and a mouse Fzd5 gRNADepositorAvailable sinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDS48
Plasmid#241839PurposeCas9-gRNA construct targeting the UBE3A locusDepositorAvailable sinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-EF1aCore-SaCas9-dual(U6-sgRNA(backbone))-ITR
Plasmid#207878PurposeAAV vector encoding EF1a core promoter-driven SaCas9 and two sgRNA cloning sites w/ the engineered Sa Guide scaffold variant (BbsI and PaqCI for sgRNA cloning).DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable sinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPten#2/Cre
Plasmid#173646PurposeExpresses a Pten-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pten (Pten Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgEp300#1/Cre
Plasmid#173591PurposeExpresses a Ep300-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ep300 (Ep300 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTp53#2/Cre
Plasmid#173621PurposeExpresses a Tp53-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Tp53 (Trp53 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
LsgRNA-FXR1-KH1-gRNA
Plasmid#225483PurposeExpress gRNA for FXR1DepositorAvailable sinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
BPK1520-FXR1-N202S-gRNA
Plasmid#225481PurposeExpress gRNA for FXR1DepositorAvailable sinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-gRNA-TAZ
Plasmid#86688PurposeExpresses a gRNA targeted to human TAZDepositorAvailable sinceMarch 2, 2017AvailabilityAcademic Institutions and Nonprofits only