We narrowed to 15,623 results for: grna
-
Plasmid#174839PurposepRS414 backbone containing LINEAR fragment targeting ADE2 in H. polymorphaDepositorInsertHH-gRNA-HDV targetting ADE2 in Ogataea (para)polymorpha
UseCRISPR and Synthetic BiologyExpressionBacterial and YeastPromoterTDH3pAvailable SinceJan. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-VP64-pU6-sgRNA
Plasmid#158972PurposeVector C encodes pAAV-pMecp2-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in neuronsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceSept. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 U6-26:gRNA 4 (Pnos):2.1 aptamer (GB1724)
Plasmid#160621PurposeTarget for the Nopaline Synthetase Promoter with the MS2 recognition 2.1 loop in position3' in the scaffoldDepositorInsertU6-26:gRNA 4 (pNos): 2.1 aptamer
UseCRISPR and Synthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterU6-26Available SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-Lrp5 gRNA
Plasmid#246548PurposeCRISPR vector co-expressing Cas9 and a mouse Lrp5 gRNADepositorAvailable SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-Fzd5 gRNA
Plasmid#246564PurposeCRISPR vector co-expressing Cas9 and a mouse Fzd5 gRNADepositorAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDS48
Plasmid#241839PurposeCas9-gRNA construct targeting the UBE3A locusDepositorAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-EF1aCore-SaCas9-dual(U6-sgRNA(backbone))-ITR
Plasmid#207878PurposeAAV vector encoding EF1a core promoter-driven SaCas9 and two sgRNA cloning sites w/ the engineered Sa Guide scaffold variant (BbsI and PaqCI for sgRNA cloning).DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPten#2/Cre
Plasmid#173646PurposeExpresses a Pten-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pten (Pten Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgEp300#1/Cre
Plasmid#173591PurposeExpresses a Ep300-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ep300 (Ep300 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTp53#2/Cre
Plasmid#173621PurposeExpresses a Tp53-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Tp53 (Trp53 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT57
Plasmid#223429PurposeT-DNA vector for dSpCas9 mediated gene activation for dicot plants; NGG PAM; dSpCas9-Act3.0 was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-dSpCas9-Act3.0-AtU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
LsgRNA-FXR1-KH1-gRNA
Plasmid#225483PurposeExpress gRNA for FXR1DepositorAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
BPK1520-FXR1-N202S-gRNA
Plasmid#225481PurposeExpress gRNA for FXR1DepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-gRNA-TAZ
Plasmid#86688PurposeExpresses a gRNA targeted to human TAZDepositorAvailable SinceMarch 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Arpc5 KI
Plasmid#131503PurposeEndogenous tagging of Arp2/3 complex subunit 5: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pST_119_LVL2 cam
Plasmid#179333PurposeNT-CRISPR plasmid for integration of multiple gRNAs.DepositorInsertPtac tfoX, Ptet cas9, PJ23106 acrIIA4, sfGFP dropout to be replaced with gRNAs
UseCRISPRAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2515
Plasmid#91083PurposeModule C, Promoter: AtU6, Gene: Esp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning), Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning)
UseCRISPRPromoterAtU6Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only