Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pT7ddx19gRNA
(Plasmid #47932)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 47932 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pT7-gRNA
  • Backbone size w/o insert (bp) 2542
  • Total vector size (bp) 2526
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ddx19 gRNA
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    20
  • Entrez Gene
    ddx19 (a.k.a. chunp6915, fi21a04, wu:fb24g07, wu:fc59e08, wu:fd14f03, wu:fi21a04)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer M13 Rev
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/

gRNA target sequence GGCAACAGATTCGTGGGCCC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT7ddx19gRNA was a gift from Wenbiao Chen & Susan Wente (Addgene plasmid # 47932 ; http://n2t.net/addgene:47932 ; RRID:Addgene_47932)
  • For your References section:

    Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Jao LE, Wente SR, Chen W. Proc Natl Acad Sci U S A. 2013 Aug 5. 10.1073/pnas.1308335110 PubMed 23918387