pT7ddx19gRNA
(Plasmid
#47932)
-
Purposein vitro transcription of ddx19 gRNA
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 47932 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepT7-gRNA
- Backbone size w/o insert (bp) 2542
- Total vector size (bp) 2526
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameddx19 gRNA
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)20
-
Entrez Geneddx19 (a.k.a. chunp6915, fi21a04, wu:fb24g07, wu:fc59e08, wu:fd14f03, wu:fi21a04)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer M13 Rev (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Depositor Comments
For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/
gRNA target sequence GGCAACAGATTCGTGGGCCC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7ddx19gRNA was a gift from Wenbiao Chen & Susan Wente (Addgene plasmid # 47932 ; http://n2t.net/addgene:47932 ; RRID:Addgene_47932) -
For your References section:
Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Jao LE, Wente SR, Chen W. Proc Natl Acad Sci U S A. 2013 Aug 5. 10.1073/pnas.1308335110 PubMed 23918387